ID: 1163189602

View in Genome Browser
Species Human (GRCh38)
Location 19:15666898-15666920
Sequence CTGCTGATGGGAGGTGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163189597_1163189602 -1 Left 1163189597 19:15666876-15666898 CCTGATAGGAGGTAGCTCCTAGC No data
Right 1163189602 19:15666898-15666920 CTGCTGATGGGAGGTGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163189602 Original CRISPR CTGCTGATGGGAGGTGCTTC TGG Intergenic
No off target data available for this crispr