ID: 1163193929

View in Genome Browser
Species Human (GRCh38)
Location 19:15701408-15701430
Sequence CATCTCACCCCCATTGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163193926_1163193929 15 Left 1163193926 19:15701370-15701392 CCATCTGGGAAATGGGAATCAAA No data
Right 1163193929 19:15701408-15701430 CATCTCACCCCCATTGAAATGGG No data
1163193927_1163193929 -9 Left 1163193927 19:15701394-15701416 CCACAGTGAGATAACATCTCACC No data
Right 1163193929 19:15701408-15701430 CATCTCACCCCCATTGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163193929 Original CRISPR CATCTCACCCCCATTGAAAT GGG Intergenic
No off target data available for this crispr