ID: 1163207446

View in Genome Browser
Species Human (GRCh38)
Location 19:15814034-15814056
Sequence GCCACAGACATCCCTAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163207442_1163207446 21 Left 1163207442 19:15813990-15814012 CCACTCAGAGACTCTAGGGCTAA No data
Right 1163207446 19:15814034-15814056 GCCACAGACATCCCTAGAGCAGG No data
1163207439_1163207446 29 Left 1163207439 19:15813982-15814004 CCAGTTCTCCACTCAGAGACTCT No data
Right 1163207446 19:15814034-15814056 GCCACAGACATCCCTAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163207446 Original CRISPR GCCACAGACATCCCTAGAGC AGG Intergenic
No off target data available for this crispr