ID: 1163209750

View in Genome Browser
Species Human (GRCh38)
Location 19:15831600-15831622
Sequence CTGTAGCCCAGCAATAGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163209750_1163209756 13 Left 1163209750 19:15831600-15831622 CCCTGACTATTGCTGGGCTACAG No data
Right 1163209756 19:15831636-15831658 CTGTCCTTTTCCCCAATTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163209750 Original CRISPR CTGTAGCCCAGCAATAGTCA GGG (reversed) Intergenic
No off target data available for this crispr