ID: 1163211822

View in Genome Browser
Species Human (GRCh38)
Location 19:15846488-15846510
Sequence CCGTGAACTTCCCATGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163211822_1163211827 -10 Left 1163211822 19:15846488-15846510 CCAGCAGCATGGGAAGTTCACGG No data
Right 1163211827 19:15846501-15846523 AAGTTCACGGGGGCCACAGCTGG No data
1163211822_1163211830 22 Left 1163211822 19:15846488-15846510 CCAGCAGCATGGGAAGTTCACGG No data
Right 1163211830 19:15846533-15846555 TTTTCCACGCTTTGCTTCTGAGG No data
1163211822_1163211831 23 Left 1163211822 19:15846488-15846510 CCAGCAGCATGGGAAGTTCACGG No data
Right 1163211831 19:15846534-15846556 TTTCCACGCTTTGCTTCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163211822 Original CRISPR CCGTGAACTTCCCATGCTGC TGG (reversed) Intergenic
No off target data available for this crispr