ID: 1163211834

View in Genome Browser
Species Human (GRCh38)
Location 19:15846557-15846579
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163211834_1163211836 -5 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211836 19:15846575-15846597 TTCTGTAGCATTTAACTGTGTGG No data
1163211834_1163211843 30 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG No data
1163211834_1163211841 21 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211841 19:15846601-15846623 TCTGGGACTCTTGTGTCTTGGGG No data
1163211834_1163211838 4 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211838 19:15846584-15846606 ATTTAACTGTGTGGAGCTCTGGG No data
1163211834_1163211842 22 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211842 19:15846602-15846624 CTGGGACTCTTGTGTCTTGGGGG No data
1163211834_1163211839 19 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211839 19:15846599-15846621 GCTCTGGGACTCTTGTGTCTTGG No data
1163211834_1163211840 20 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211840 19:15846600-15846622 CTCTGGGACTCTTGTGTCTTGGG No data
1163211834_1163211837 3 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211837 19:15846583-15846605 CATTTAACTGTGTGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163211834 Original CRISPR CAGAAAGCACCATGGCATCT TGG (reversed) Intergenic
No off target data available for this crispr