ID: 1163211843

View in Genome Browser
Species Human (GRCh38)
Location 19:15846610-15846632
Sequence CTTGTGTCTTGGGGGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163211835_1163211843 22 Left 1163211835 19:15846565-15846587 CCATGGTGCTTTCTGTAGCATTT No data
Right 1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG No data
1163211834_1163211843 30 Left 1163211834 19:15846557-15846579 CCAAGATGCCATGGTGCTTTCTG No data
Right 1163211843 19:15846610-15846632 CTTGTGTCTTGGGGGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163211843 Original CRISPR CTTGTGTCTTGGGGGAAGAA AGG Intergenic
No off target data available for this crispr