ID: 1163215125

View in Genome Browser
Species Human (GRCh38)
Location 19:15871025-15871047
Sequence CTCAGCTCTGCTGTGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163215125_1163215127 -2 Left 1163215125 19:15871025-15871047 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163215127 19:15871046-15871068 AGGCTTGAGCCCAAGCAGTCCGG No data
1163215125_1163215132 20 Left 1163215125 19:15871025-15871047 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163215132 19:15871068-15871090 GCTCCAGATCCCATGCCTTTGGG No data
1163215125_1163215131 19 Left 1163215125 19:15871025-15871047 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163215131 19:15871067-15871089 GGCTCCAGATCCCATGCCTTTGG No data
1163215125_1163215134 23 Left 1163215125 19:15871025-15871047 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163215134 19:15871071-15871093 CCAGATCCCATGCCTTTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163215125 Original CRISPR CTCAGCTCTGCTGTGTGACT TGG (reversed) Intergenic
No off target data available for this crispr