ID: 1163217486

View in Genome Browser
Species Human (GRCh38)
Location 19:15891779-15891801
Sequence TTCTCTCACGTGTCTAGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 98}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163217486_1163217492 12 Left 1163217486 19:15891779-15891801 CCAAACCTAGACACGTGAGAGAA 0: 1
1: 0
2: 0
3: 4
4: 98
Right 1163217492 19:15891814-15891836 CCAGCCAAAACCCAAACATGTGG 0: 1
1: 0
2: 1
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163217486 Original CRISPR TTCTCTCACGTGTCTAGGTT TGG (reversed) Intronic
901005214 1:6168412-6168434 TTCTCTCACTTCACTGGGTTTGG - Intronic
905150160 1:35920977-35920999 TTCTCTGACCTGGCTAGGTAGGG + Exonic
906179717 1:43807825-43807847 TTCTCTCAGGTTTCAAGTTTGGG + Intronic
912730873 1:112102277-112102299 TTCTCTCACTAGTCAAGGGTTGG - Intergenic
913129564 1:115827519-115827541 TTCTTTTCCGTGTTTAGGTTTGG + Intergenic
915451595 1:156009215-156009237 TTCTCTCAGGGGTCTAGGAGGGG - Exonic
917067907 1:171117083-171117105 TTCTCTCCCATCTCCAGGTTTGG + Exonic
918211765 1:182357710-182357732 TTTTCTCATGTAACTAGGTTAGG - Intergenic
919541941 1:198858039-198858061 CTTTCTCAAGTGTCTATGTTTGG - Intergenic
920931948 1:210396980-210397002 TTTTATCACATGTATAGGTTTGG - Intronic
924290095 1:242526936-242526958 ATCTATCACTTGTCAAGGTTTGG - Intergenic
1063061781 10:2563203-2563225 CTCACTTACATGTCTAGGTTGGG + Intergenic
1072015141 10:91339313-91339335 TTTTCTATCGTGTCTAGGTATGG - Intergenic
1073011037 10:100359863-100359885 TTCTCTAACGTGTAAAGCTTTGG - Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1079616552 11:22501178-22501200 TTCTTTTAGGTGTCTGGGTTTGG - Intergenic
1084838148 11:71821254-71821276 TTTTCTCAGGACTCTAGGTTGGG - Intergenic
1086812295 11:91325325-91325347 TTCTCTCATGTGTCTGTGCTTGG + Intergenic
1089029812 11:115313915-115313937 TTCACTCACTAGTCTAGGGTGGG - Intronic
1095469377 12:42520141-42520163 CCCTCTCAAGTGTCCAGGTTTGG + Intronic
1097171747 12:57118621-57118643 TTCTCTCAAGTGTATAGGGCGGG - Intronic
1109895494 13:68682411-68682433 TTCTCTCACATTTCTAATTTTGG - Intergenic
1111612987 13:90628524-90628546 TTCTTTCACGGATTTAGGTTTGG - Intergenic
1116075224 14:40102146-40102168 TTCTCTCCTGTGGATAGGTTGGG + Intergenic
1117284267 14:54271694-54271716 TTCCCTCACGTGTTAAGGTTGGG + Intergenic
1124631335 15:31339216-31339238 TTGTCTCAAGTTTCTAGGATGGG + Intronic
1125348644 15:38744472-38744494 TTCTTTCACGTCTTTATGTTTGG - Intergenic
1126528002 15:49679160-49679182 TTTTCTCACTTGCCAAGGTTTGG - Intergenic
1128710500 15:69867923-69867945 TTCTCCCAAGTGTCTGGCTTGGG + Intergenic
1128731026 15:70021321-70021343 TTCTCTTACGTGTCTTCATTCGG - Intergenic
1133151116 16:3831631-3831653 TTCTCTCATTGATCTAGGTTGGG - Intronic
1138639479 16:58372150-58372172 TTTTATCACATGTGTAGGTTTGG + Intronic
1140868483 16:79085205-79085227 TTCTCTCACTTGACTCTGTTGGG + Intronic
1144041298 17:11413580-11413602 TTCTCTCATGTGGCTATGCTTGG + Intronic
1147019773 17:37521869-37521891 TTCTCTCACGTGTCTTATTATGG - Intronic
1147476804 17:40719847-40719869 TTCTCTCACTTTGCCAGGTTAGG + Intergenic
1147702024 17:42402326-42402348 TTGTCTCACGTGCCTGGGGTGGG - Intergenic
1148724105 17:49776386-49776408 ATTTCTCACTTGTCTAGGTCTGG - Intronic
1149053855 17:52338785-52338807 TTCTCTCACTTCTCTGTGTTGGG + Intergenic
1150870090 17:68898033-68898055 TACTCTGATGTGTCTGGGTTTGG - Intronic
1153451105 18:5230189-5230211 TTCTCTCCTGCTTCTAGGTTTGG + Intergenic
1154358271 18:13639306-13639328 GTGTCTCCCTTGTCTAGGTTGGG - Intronic
1157131187 18:45008845-45008867 CTCTCTCTGCTGTCTAGGTTGGG + Intronic
1163217486 19:15891779-15891801 TTCTCTCACGTGTCTAGGTTTGG - Intronic
1163300004 19:16438954-16438976 TTCCTTCCCGTGTCTAGGTGGGG - Intronic
1164395609 19:27860664-27860686 TTCTCTCAAGTGCCTGGGATTGG - Intergenic
1167474594 19:49692377-49692399 ATCTCTCACGTTTCTGGGTGAGG + Exonic
929110235 2:38400176-38400198 TTCCTTCATGTGTATAGGTTTGG - Intergenic
930694936 2:54401744-54401766 TTCTCTTATTTGTCTAGATTTGG - Intergenic
933118393 2:78502790-78502812 TTTTGTCACGTGTCTAGTTCAGG - Intergenic
943230498 2:185244725-185244747 TTGTCACACGTGTACAGGTTAGG - Intergenic
944258367 2:197648744-197648766 TTCTCTTACGTGTCTTGCTTTGG + Intronic
1170377557 20:15717594-15717616 ATGTCTCAGGTGTCTAGATTAGG - Intronic
1173768676 20:45638305-45638327 TTATCCCACTTGTCTAGTTTTGG + Intergenic
1176989483 21:15478005-15478027 TTCTCCCATGTGTCAAGGGTAGG - Intergenic
1178828939 21:36038909-36038931 TTCTTTCTAGTGTCTAGGTCTGG - Intronic
1181725943 22:24810972-24810994 TTGTCTCCCGTCCCTAGGTTTGG + Intronic
1181755021 22:25017692-25017714 CTCTCTAAGATGTCTAGGTTTGG - Intronic
1182817657 22:33180128-33180150 TTCTCACAGGTCTGTAGGTTGGG - Intronic
951896417 3:27613757-27613779 TTCTATCAAGTTTCTAGGGTTGG - Intergenic
956847027 3:73193152-73193174 TTTTATCACCTGTCTGGGTTGGG + Intergenic
957026246 3:75185604-75185626 TTCTCCCACCAGTCTAGCTTAGG - Intergenic
958989309 3:100824022-100824044 TTCTCTTAGGTGTCATGGTTTGG - Intronic
963408051 3:144893450-144893472 TTCTTTTACTTCTCTAGGTTAGG - Intergenic
966736919 3:183194161-183194183 TTCTCTCATCTTTCTGGGTTAGG + Intronic
966772781 3:183518791-183518813 TTCTCTCACGTCTCCTGTTTTGG - Intronic
970082395 4:12302106-12302128 ATCTTTCAGGTGTTTAGGTTTGG + Intergenic
974342340 4:60630459-60630481 TGGTCTCACTTGTCTAAGTTTGG + Intergenic
978725228 4:111961398-111961420 TTCTCTCAATTGTCTTGGTAAGG - Intergenic
984184677 4:176529365-176529387 TTTTCTGGCGTGTCTAGGTCTGG + Intergenic
984901203 4:184588046-184588068 TTGTCTCACGTATCTTGGGTTGG - Intergenic
985353674 4:189094765-189094787 TTTTTTCTCGTGTCTAGGCTTGG - Intergenic
985859863 5:2462308-2462330 TTCTCTAACCTGCCCAGGTTGGG - Intergenic
997926337 5:138033571-138033593 TTCTCTCTGGAGTCTAGGTCAGG - Intronic
1000846491 5:166288269-166288291 TTCTCTCCTGTGTCTTGGTTAGG + Intergenic
1001720796 5:173855475-173855497 TTCTCTCACTTGTGTAGTTCGGG + Intergenic
1003473631 6:6461352-6461374 TTCTAACACCTGTCTTGGTTTGG + Intergenic
1004455387 6:15787078-15787100 TTCTATGACGTGGCTGGGTTAGG + Intergenic
1014855250 6:126392758-126392780 TTTTCTCATGTGTCTTGGTCTGG + Intergenic
1021571289 7:22067759-22067781 CTCTCACAAGTGTCCAGGTTTGG + Intergenic
1026334179 7:69379580-69379602 ATCTCTCTGGTGTCCAGGTTGGG - Intergenic
1031627379 7:124006010-124006032 TTTTCTCATGTGTCCAGGCTTGG + Intergenic
1032315950 7:130838617-130838639 TTCTCTAACATGTCTTGGTTTGG + Intergenic
1036277000 8:7362721-7362743 TTTTCTCAGGACTCTAGGTTGGG - Intronic
1036344333 8:7947621-7947643 TTTTCTCAGGACTCTAGGTTGGG + Intronic
1036540924 8:9709980-9710002 TTCTGTCACTTGTTTACGTTTGG - Exonic
1036839674 8:12108393-12108415 TTTTCTCAGGACTCTAGGTTGGG + Intronic
1036861466 8:12354633-12354655 TTTTCTCAGGACTCTAGGTTGGG + Intergenic
1040880151 8:52196192-52196214 TTCTCCCACCTGCCTAGGCTGGG + Intronic
1044322370 8:90818173-90818195 TTCTCTCACTTTTCTTGCTTAGG + Intronic
1044623359 8:94212521-94212543 TTCTCTCAAGTGTTCTGGTTTGG - Intronic
1045827820 8:106421509-106421531 TTCTCTCACATGGCTAGCTGTGG + Intronic
1048758117 8:137761414-137761436 TTTACTCACGTGTCTGGGTATGG - Intergenic
1049264155 8:141658029-141658051 GTCTCTCACCTGTCTACTTTTGG - Intergenic
1050141987 9:2525548-2525570 TTCTCGCACGAGTCTGGATTGGG + Intergenic
1052962605 9:34313200-34313222 TTCTTTCACATGTCTGGCTTTGG - Intronic
1058465599 9:105223964-105223986 TACTGTCACGTGTCTGGGTGTGG + Intergenic
1061320744 9:129827454-129827476 TGCTTTCACGTGTCTGGGATGGG - Exonic
1191752892 X:64562912-64562934 TTCTGTGAATTGTCTAGGTTGGG - Intergenic
1192598374 X:72436017-72436039 TTCTCTCCATTGTCTAGATTGGG - Intronic
1194365651 X:93010817-93010839 TTCTCTGTCTTCTCTAGGTTAGG + Intergenic
1197970292 X:132108548-132108570 TCCTCTAAAGTGTCCAGGTTAGG - Intronic
1200673869 Y:6127067-6127089 TTCTCTGTCTTCTCTAGGTTAGG + Intergenic