ID: 1163218213

View in Genome Browser
Species Human (GRCh38)
Location 19:15896316-15896338
Sequence GGACCCAAGAGAGATAGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 12, 4: 216}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163218213_1163218222 13 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218222 19:15896352-15896374 AAGGGTGCATCCCAGGGCAGAGG 0: 1
1: 1
2: 4
3: 28
4: 334
1163218213_1163218215 -5 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218215 19:15896334-15896356 GGTCCATCTCCAAGTCCCAAGGG 0: 1
1: 0
2: 0
3: 12
4: 112
1163218213_1163218214 -6 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218214 19:15896333-15896355 GGGTCCATCTCCAAGTCCCAAGG 0: 1
1: 0
2: 1
3: 18
4: 136
1163218213_1163218223 14 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218223 19:15896353-15896375 AGGGTGCATCCCAGGGCAGAGGG 0: 1
1: 1
2: 1
3: 23
4: 298
1163218213_1163218218 6 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218218 19:15896345-15896367 AAGTCCCAAGGGTGCATCCCAGG 0: 1
1: 0
2: 1
3: 10
4: 105
1163218213_1163218219 7 Left 1163218213 19:15896316-15896338 CCTGCTCTATCTCTCTTGGGTCC 0: 1
1: 1
2: 1
3: 12
4: 216
Right 1163218219 19:15896346-15896368 AGTCCCAAGGGTGCATCCCAGGG 0: 1
1: 0
2: 2
3: 10
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163218213 Original CRISPR GGACCCAAGAGAGATAGAGC AGG (reversed) Intronic
900308689 1:2023250-2023272 GGACTCAAGAGGGCTGGAGCCGG + Intronic
900405032 1:2489180-2489202 GGCCCCAAGGCAGAAAGAGCAGG - Intronic
901207960 1:7508145-7508167 GGAGCCCAGAGAGGTGGAGCTGG + Intronic
902554461 1:17238818-17238840 GGACCCAAGAAACAGAGAGTGGG - Intronic
904607331 1:31704971-31704993 GGACGCAAGAGGAATTGAGCTGG + Intergenic
904607970 1:31708843-31708865 GGACCTACGAAAGAGAGAGCTGG - Intergenic
905393618 1:37653377-37653399 GGACCCCAGAGAGGGAGAGATGG + Intergenic
906607196 1:47180858-47180880 GGATGCAAGAGAGAAAGAGGAGG + Intergenic
911557278 1:99360281-99360303 GAAGACAAGAGAGATAGAGCAGG - Intergenic
912694443 1:111830468-111830490 GGACCCAAGTGAGACAAGGCAGG + Intronic
918216092 1:182392420-182392442 AGACCCAAGAGAGCCGGAGCGGG - Intergenic
918433849 1:184490430-184490452 GGAACTAAGTGAGACAGAGCAGG + Intronic
918451227 1:184661146-184661168 AGACCCTGGAGAGATAGAGGCGG - Intergenic
919928519 1:202206342-202206364 GGACCCAAAGGAGTCAGAGCCGG + Intronic
1063101499 10:2953893-2953915 GGACCCTAATCAGATAGAGCTGG - Intergenic
1065419967 10:25532190-25532212 GGACCCTAAAGAGAAAGAGGTGG + Intronic
1067140686 10:43653846-43653868 GGAAGCAAGAGAGACAGAGGAGG + Intergenic
1070572052 10:77647340-77647362 GGTCCTCAGAGAGAAAGAGCTGG - Intergenic
1071346377 10:84697882-84697904 GGACCCCAGAGACAGGGAGCTGG + Intergenic
1071424477 10:85534271-85534293 GGACCTAACAGAGATAGAAGTGG - Intergenic
1072549108 10:96463690-96463712 GGTCCCAAGGGAGCTGGAGCTGG - Intronic
1074491369 10:113942239-113942261 GCACGCAAGAGAGATTGTGCAGG - Intergenic
1074794128 10:116924006-116924028 GTTCCCAAGCTAGATAGAGCAGG - Intronic
1075458987 10:122603257-122603279 GGACCCATGTGAAATACAGCCGG - Intronic
1075459619 10:122607316-122607338 GGACCCATGTGAAATACAGCCGG - Intronic
1075460251 10:122611375-122611397 GGACCCATGTGAAATACAGCCGG - Intronic
1075460883 10:122615434-122615456 GGACCCATGTGAAATACAGCCGG - Intronic
1076732165 10:132444380-132444402 GGACCCCAGAGGGAATGAGCAGG - Intronic
1076863239 10:133152620-133152642 GGGTCCAAGAGAGAGAGAACAGG + Intergenic
1078248929 11:9601387-9601409 GGCCCCAGCAGAGACAGAGCTGG + Intergenic
1080036757 11:27719423-27719445 GGACCGAAGAGCCAGAGAGCGGG - Intronic
1081757904 11:45557678-45557700 GGACCCAAGCCAGAAAGAGGAGG - Intergenic
1087645085 11:100799617-100799639 GGAGCCAAGAGAAATAGTTCTGG + Intronic
1087932750 11:103997533-103997555 GCACCCAAGAGATATGGAGCTGG - Intronic
1088138326 11:106584586-106584608 GGAACCAATAGAGAGAGAGTGGG - Intergenic
1089150686 11:116361521-116361543 GGGCCCAGGAGAGAAAGAGGTGG + Intergenic
1089591706 11:119546182-119546204 GGACCCCAGAGACACAGACCAGG - Intergenic
1089603785 11:119630049-119630071 GGACCCAGGAGACAGGGAGCTGG + Intronic
1089640245 11:119843199-119843221 GGAGCCAGGAGAGGGAGAGCAGG + Intergenic
1090452745 11:126821025-126821047 AGTCCCAAGAGAGATAAAGAGGG - Intronic
1091215260 11:133897335-133897357 GCACGCAAGAGAGTGAGAGCGGG - Intergenic
1092103356 12:5903590-5903612 GGAACCAAGAGTGGCAGAGCTGG - Intronic
1092503108 12:9066529-9066551 GGATCCAAGGGAGATTGAGACGG - Intergenic
1092726121 12:11487240-11487262 GGTCCCAAGAGAGACATAGGAGG + Intronic
1093669333 12:21854016-21854038 GGGCCCAAGAAAGAAGGAGCTGG + Intronic
1095853283 12:46832607-46832629 GGACCCAGGAAAGAGGGAGCAGG - Intergenic
1099032040 12:77538472-77538494 TGACCAAAAAGAGTTAGAGCTGG - Intergenic
1101163547 12:102005101-102005123 GGAAGCAAGAGTGAGAGAGCAGG - Intronic
1103270009 12:119665484-119665506 TGACCCAAGAGAGACACAGCTGG + Intergenic
1104084419 12:125461149-125461171 GTACCCAGGAGAGCCAGAGCTGG + Intronic
1104286198 12:127426928-127426950 GTACCCAGGAGAGCCAGAGCTGG - Intergenic
1106995843 13:35478748-35478770 GAACCCAAGGGAGAGAGCGCAGG - Intronic
1107788476 13:43977713-43977735 GGACGGAAGAGAGAGAGAGAGGG - Intergenic
1107814616 13:44233104-44233126 GGACCCTGGAGAGCTAGAGGAGG + Intergenic
1110301846 13:73937725-73937747 GTACCCAAGGGAAATATAGCAGG - Intronic
1110317113 13:74122065-74122087 GGACACCAGAGAGAAAGAGAAGG + Intronic
1112149171 13:96737917-96737939 GGAGGCAAGAGAGAAAGAGAAGG - Intronic
1113721546 13:112561501-112561523 GGACAAACGAGAGATATAGCTGG + Intronic
1113917859 13:113884859-113884881 GGAACCAAGGGAGACAGAGATGG - Intergenic
1114271199 14:21101338-21101360 GGAGCCATGGAAGATAGAGCTGG + Exonic
1116632718 14:47355540-47355562 GGACCCTATAGATATAGTGCAGG + Intronic
1117708791 14:58501727-58501749 TGACCAAAGATACATAGAGCTGG - Intronic
1117823299 14:59673689-59673711 GGAACCAACAGAGAGAGAGGAGG + Intronic
1120000922 14:79302450-79302472 GGAAGCAAGAGAGATAGGGGAGG + Intronic
1120768383 14:88352884-88352906 GAAAACAAGAGAGATAGAGTGGG - Intergenic
1126038838 15:44571450-44571472 GGACCGAGAAGAGATAGAGAAGG + Intronic
1130062036 15:80577254-80577276 GGACCCAAGTGAGCTGGAGCTGG + Intronic
1131153287 15:90060033-90060055 GGACCCAACAGAGCAAGAGCGGG - Intronic
1133633906 16:7648301-7648323 GAACCCAGGAGAGGTAGAGGAGG - Intronic
1135522478 16:23188016-23188038 GGACCAGAGAGAGAGAGAGAAGG - Intronic
1138389678 16:56661330-56661352 GGACCCCAGAGAGGCAAAGCTGG - Intronic
1139465530 16:67151946-67151968 GGGACCAAGAAAGAGAGAGCTGG - Intergenic
1140478511 16:75250716-75250738 GGACCCGCAAGAGCTAGAGCAGG - Intronic
1141598914 16:85113689-85113711 GGACCCAGCAGGGACAGAGCTGG - Intergenic
1141746522 16:85929969-85929991 GGAACCAAAGGAGACAGAGCAGG - Intergenic
1142196576 16:88741962-88741984 GGACCCAGGAGGGACAGAGGGGG - Intronic
1142615252 17:1130520-1130542 GGACCCTGGAGAGGTGGAGCAGG - Intronic
1143103374 17:4515863-4515885 GGTCCCAAGAGGGAAACAGCAGG - Intronic
1144641385 17:16939235-16939257 GGGACAGAGAGAGATAGAGCAGG - Exonic
1146570283 17:33946650-33946672 GGAGCAAAGAGAGATGGAGAAGG + Intronic
1147450312 17:40500235-40500257 GGAACCAAGAGGGACAGACCTGG + Intronic
1148604636 17:48919815-48919837 GGACCCTAGAGACATATAACAGG + Intronic
1151164185 17:72190052-72190074 GAAGCCAAGAGAGAGAGAGCTGG - Intergenic
1156718560 18:40042097-40042119 GGACCAAAGGGAAAGAGAGCTGG - Intergenic
1157139371 18:45090314-45090336 GGACCCAAGTGAGATCCTGCAGG + Intergenic
1159859570 18:73631495-73631517 GGAGTCAACAGAGACAGAGCGGG - Intergenic
1161395495 19:4043041-4043063 GGACCCCAGAGAGATGGGCCTGG + Intergenic
1162567968 19:11454425-11454447 GGGCCCAAGAGAGACAGCACAGG - Exonic
1163186530 19:15642699-15642721 GGCCCCAAGAGAGATAGAGCAGG + Intronic
1163218213 19:15896316-15896338 GGACCCAAGAGAGATAGAGCAGG - Intronic
1163222283 19:15930264-15930286 AGCCCCAAGAGAGAAGGAGCAGG - Intronic
1163716128 19:18873365-18873387 GGAGGCCAGAGAGACAGAGCAGG + Intronic
1164412015 19:28014118-28014140 GGACCCAGCAGGGATGGAGCTGG + Intergenic
1164457809 19:28423157-28423179 GCACCAAAGAGAGAGAGAGAGGG + Intergenic
1167359300 19:49021399-49021421 GGACCTGAGAGAGAGAGAGGGGG + Intergenic
925556671 2:5138404-5138426 GGACAGAAGAGAGAGAGAGAGGG - Intergenic
925579581 2:5397050-5397072 AGACCCAGGAGGGATGGAGCAGG + Intergenic
925669409 2:6294700-6294722 GATCCCAAGAGAGATGGGGCTGG - Intergenic
926319507 2:11739128-11739150 TGACCCAAGAGAGAGCAAGCAGG - Intronic
930029937 2:47052203-47052225 GGCCCCAAGAAAGAGAGGGCTGG + Intronic
932407451 2:71522965-71522987 AGACCCAAGTGAGAGAGAGTGGG - Intronic
933346176 2:81088478-81088500 GGACTGTAGAGAGATGGAGCTGG + Intergenic
934913530 2:98279711-98279733 GAGCCCTAGAGAGAAAGAGCAGG + Intronic
936137288 2:109906152-109906174 GGACCCAATAGAGCTTGAACTGG - Intergenic
936207409 2:110465333-110465355 GGACCCAATAGAGCTTGAACTGG + Exonic
937107193 2:119327613-119327635 GGAAGCAAGAGAGAGAGAGAGGG - Intronic
937829414 2:126403302-126403324 GGGCCCATGACAGATGGAGCTGG + Intergenic
939374270 2:141343922-141343944 GAGCCAAAGAGAGAGAGAGCTGG - Intronic
939834499 2:147112111-147112133 GGGAGCAAGAGAGAGAGAGCAGG - Intergenic
940392089 2:153144040-153144062 TGACCCATGAGAGCTAGAGGTGG - Intergenic
940525413 2:154807891-154807913 GAACCCAAGAGGGATAGAGTGGG - Intronic
942465456 2:176203170-176203192 GGAACCAAAAGAGATGGAGGGGG - Intergenic
942855880 2:180547047-180547069 GGAATCAAGAGAGAGAGAGAGGG - Intergenic
943234586 2:185300962-185300984 GGACCCCATAGAGTTAGAGTTGG + Intergenic
944694412 2:202188212-202188234 GGACCCAAAAGCGAGAGAGAAGG + Exonic
945143466 2:206712573-206712595 GGAGCCAGGAGAGACAGAGTGGG + Intronic
946581107 2:221128945-221128967 GGAAGCAAGAGAGAGAGAGAAGG - Intergenic
948303857 2:236932162-236932184 GGACCAGAGAAAGAAAGAGCTGG + Intergenic
948547530 2:238743359-238743381 GGCCCCAAGAGAGCAAGCGCTGG - Intergenic
1170313340 20:15016598-15016620 GGAAGCAAGAGAGAGAGAGGGGG - Intronic
1173430598 20:42983873-42983895 GGACCCATGGGAGATGGAGATGG - Intronic
1174790063 20:53469744-53469766 GGACCCAAGAAAGATAGAGAGGG + Intronic
1175333717 20:58181456-58181478 TGACACAGGAGAGAGAGAGCGGG + Intergenic
1175372258 20:58499820-58499842 AGACTCAAGAGAGACAGAGAGGG - Intronic
1178546425 21:33496459-33496481 GGACCCAGGAGAGAGAGAGAGGG - Intergenic
1178809722 21:35870437-35870459 GGAACCATGAGAGAAAGTGCTGG - Intronic
1180724604 22:17937185-17937207 GAAGCCAAAAGAGATAAAGCAGG - Intronic
1181019593 22:20092352-20092374 GCACCCAAGGAAGACAGAGCTGG - Intronic
1182120808 22:27785496-27785518 GAATCGAAGAGAGAAAGAGCTGG - Intronic
1183092775 22:35534558-35534580 GCAGCCAGGAGAGAAAGAGCTGG - Intergenic
1183148277 22:36015990-36016012 TGGCCCAAGACAAATAGAGCAGG + Intronic
1184586577 22:45452166-45452188 GGAGCCAAGTGAGAGAGAGAAGG - Intergenic
949902095 3:8824054-8824076 TGACCCAGGAGAGACAGAGTTGG - Intronic
954157349 3:48693827-48693849 GAACACAAGGCAGATAGAGCTGG + Intronic
954948798 3:54450625-54450647 GGAAGCAAGAGAGAGAGGGCCGG - Intronic
957709485 3:83837188-83837210 AGACATAAGAGAGAGAGAGCGGG + Intergenic
958501793 3:94920225-94920247 GGATTCAAGAGAAATAGAGTGGG + Intergenic
958863278 3:99469891-99469913 GGAAGCAGGAGAGATGGAGCAGG + Intergenic
960156580 3:114302477-114302499 GTGCCCAGGAGAGATACAGCTGG - Intronic
960208743 3:114934097-114934119 GGACCTAAGAGAGACAGAAAAGG - Intronic
960460970 3:117935611-117935633 GCACCCAAGAGAGAAAGTGAAGG + Intergenic
962423790 3:135251029-135251051 AGACCTCAGAGAGGTAGAGCTGG - Intronic
963032710 3:140994873-140994895 AGACCCAAGAGAGCCAGTGCTGG + Intergenic
966887963 3:184387094-184387116 GGACCCAGGAGAGGGTGAGCTGG + Exonic
966931364 3:184677882-184677904 GTAAACAATAGAGATAGAGCTGG + Intronic
967073579 3:185982806-185982828 GGACCCAAGAGAGGCACAGAAGG + Intergenic
967714355 3:192745285-192745307 GGCGCCAGGAGAGGTAGAGCTGG - Intronic
967844924 3:194035723-194035745 GGACCAAACAGAGACAGAGGGGG + Intergenic
968930715 4:3577152-3577174 GGACCCCAGGGAGGGAGAGCAGG + Intronic
973882943 4:55292002-55292024 GGACCATACAGAGAAAGAGCCGG + Intergenic
974700962 4:65445969-65445991 GGACTCAGGAGAGATAGTGGTGG - Intronic
976362774 4:84199600-84199622 TGTCCTAAGAGAGATGGAGCAGG + Intergenic
978401130 4:108332258-108332280 GAACCTAAGAGAGAGAGAGAGGG - Intergenic
980546322 4:134267748-134267770 GGAGGTAAGAGAGATAGAGGTGG + Intergenic
985945281 5:3177503-3177525 GAACCTAAGAGAGACAGGGCAGG + Intergenic
987092846 5:14522967-14522989 GGACCCAGCAGAGACAGGGCAGG + Intronic
987639569 5:20595322-20595344 AAAACAAAGAGAGATAGAGCAGG - Intergenic
988423305 5:31032899-31032921 GGAAGCAAGAGAGAGAGAGACGG - Intergenic
992822695 5:80514050-80514072 TAACCCAGGAGAGAGAGAGCTGG + Intronic
997579139 5:135006218-135006240 GGACCCATGACAGCTAGAGTTGG - Intronic
999840462 5:155419785-155419807 AGAACTAGGAGAGATAGAGCTGG + Intergenic
1000036376 5:157451696-157451718 GGATCCTGGAGAGAAAGAGCAGG - Intronic
1000924008 5:167171705-167171727 AGACCCAAGGGAGACAGAGAGGG + Intergenic
1001562559 5:172678910-172678932 GGACCTAAGAGAGAAAGGGGAGG + Intronic
1001741861 5:174059711-174059733 GGAACCCAGAGAAATGGAGCTGG - Intronic
1003442055 6:6151946-6151968 GGACCTAAGAGAGAGAATGCAGG + Exonic
1006898446 6:37485031-37485053 GGACCCAGGATAGATACAGGGGG + Intronic
1006927677 6:37666739-37666761 GGACATAAGAGAGATATAGAAGG + Intronic
1007730561 6:43942902-43942924 GGACACAGGTGAGAAAGAGCTGG + Intergenic
1008196805 6:48534364-48534386 GGACCCAGGAGAGTTGGAACAGG - Intergenic
1008568636 6:52793469-52793491 AGATCCCAGGGAGATAGAGCAGG - Intronic
1008573092 6:52833472-52833494 AGAACCCAGGGAGATAGAGCAGG - Intronic
1008574786 6:52849568-52849590 AGATCCGAGGGAGATAGAGCAGG - Intronic
1011771815 6:90681724-90681746 GGAACCAAGAGAGAAAAAGTAGG - Intergenic
1012387128 6:98695255-98695277 GCTCCCAAGAGAGAGAGAACTGG + Intergenic
1012753343 6:103191314-103191336 GGAAACAAGAGAGACAGAGGAGG + Intergenic
1013617277 6:111856716-111856738 GGAGCCAAGAGAGTTAGAGATGG - Intronic
1013971629 6:116026693-116026715 GGATCCAAGTTAGAGAGAGCTGG + Intronic
1016894031 6:149035334-149035356 GGAGCAAATAGAGATAAAGCGGG - Intronic
1017980377 6:159395816-159395838 GGACACCAGACAGATGGAGCTGG + Intergenic
1018126934 6:160691031-160691053 GAAGCCAAGAGAGAAGGAGCTGG - Intergenic
1018173330 6:161159178-161159200 GGACCCTGGAGTGATAGGGCTGG - Intronic
1018347812 6:162921201-162921223 AGACCCAGGAGAGACAGAGTGGG + Intronic
1018464307 6:164029249-164029271 GTACCCCAGAGAGAGAGAGATGG - Intergenic
1019912538 7:4109561-4109583 GGACCCAAGGGACACAGAGAAGG - Intronic
1020256063 7:6503740-6503762 GGACCCAAGACGGAGAGGGCAGG + Intronic
1020711552 7:11612296-11612318 GGAACCTAGAGAGTGAGAGCTGG - Intronic
1020773988 7:12430735-12430757 GGATGCCAGAGAGATAGATCAGG - Intergenic
1022529711 7:31059445-31059467 GGACCCAAGAGAGAGAGCCAGGG + Intronic
1022890550 7:34693075-34693097 AGAATCAAGAGAGAGAGAGCAGG - Intronic
1022942841 7:35256281-35256303 GCACACAAGAGACACAGAGCTGG - Intergenic
1023392891 7:39727539-39727561 GGACCCAAGAGAAATAAGCCAGG - Intergenic
1027223986 7:76232702-76232724 GGAGCCAAGAGAGGTAGAGGAGG + Intronic
1028115419 7:86991722-86991744 GAAGCCAAGAGAGATAAAGCAGG - Intronic
1028401515 7:90430565-90430587 GGACCCCTGTGAGATAAAGCTGG - Intronic
1029365042 7:100111318-100111340 GGACCTAAGGGAGAAAGGGCGGG + Exonic
1031547608 7:123068977-123068999 GGACTGAAGAGAGAGAAAGCTGG - Intergenic
1032446507 7:131988585-131988607 GGAAGCAAGAGAGAGAGAGAGGG - Intergenic
1035121716 7:156573621-156573643 GGACCTAAGAGAAACACAGCGGG - Intergenic
1036681063 8:10874625-10874647 TGACCCAAGAGAGGAAAAGCTGG - Intergenic
1036793963 8:11742330-11742352 GGAACGTAGAGAGATAGAGGAGG - Intronic
1038717785 8:30007459-30007481 TGACCCAAGAGAGGGAGAACAGG + Intergenic
1038961427 8:32524418-32524440 GGAACCAAGAGAGAAAAAGATGG - Intronic
1039905342 8:41782123-41782145 GGGCCCAAGTGAGATGGAGCTGG - Intronic
1043385743 8:79746215-79746237 GGAGCCAAGAGAGAAATATCTGG - Intergenic
1043578305 8:81683188-81683210 GGAAACAGGAGAGATAAAGCTGG + Intronic
1044255309 8:90053346-90053368 GCACCCAAGAGAGCTTGTGCAGG + Intergenic
1046313379 8:112468044-112468066 TGACTGAAGAGAGATAGAGGTGG + Intronic
1047697089 8:127414869-127414891 TGACCTAAGAAAGAGAGAGCAGG - Exonic
1048941538 8:139404549-139404571 GGACCCAGGAGCAACAGAGCAGG + Intergenic
1049044825 8:140141308-140141330 GGTCCCAGGAGGGAGAGAGCAGG - Intronic
1049432557 8:142572029-142572051 GGACCCGCGAGAGTAAGAGCTGG + Intergenic
1051352196 9:16207481-16207503 AGACCCAAGAGAACTTGAGCTGG + Intronic
1054459404 9:65454762-65454784 GGACCCCAGGGAGGGAGAGCAGG - Intergenic
1055530559 9:77178386-77178408 GAACCCAGGCGAGAGAGAGCCGG - Intronic
1056508279 9:87278359-87278381 GGAAGCAAGAGAGAGAGAGGAGG - Intergenic
1057566642 9:96170970-96170992 TGACCCCAGATAGATGGAGCGGG + Intergenic
1059269203 9:113061459-113061481 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1059270338 9:113066908-113066930 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1059271474 9:113072358-113072380 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1059272605 9:113077802-113077824 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1059273740 9:113083244-113083266 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1059274874 9:113088690-113088712 GGAGGCAGGAGAGTTAGAGCTGG - Intergenic
1185774766 X:2793695-2793717 GGAGCCAAGAGAGAGACAGGGGG + Intronic
1186941288 X:14510453-14510475 GGCCCCCAGAGGTATAGAGCAGG + Intergenic
1187101391 X:16196500-16196522 GGAAGCAAGAGAGAGAGAGAGGG - Intergenic
1190734388 X:53246232-53246254 TGACACAATAGAGATAGAGGAGG - Intronic
1191707261 X:64106161-64106183 AGAGCCGAGAGAGATGGAGCTGG + Intergenic
1193478040 X:81991277-81991299 GTAACTGAGAGAGATAGAGCAGG + Intergenic
1194925523 X:99819446-99819468 GGACTGAAGAGAGAGAAAGCTGG + Intergenic
1200042489 X:153380085-153380107 GGCCTCAAGAGAGAAAGAGATGG + Intergenic