ID: 1163219183

View in Genome Browser
Species Human (GRCh38)
Location 19:15902385-15902407
Sequence GATGAAGGAGACACTGCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 2, 2: 2, 3: 39, 4: 403}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163219183_1163219188 1 Left 1163219183 19:15902385-15902407 CCACCTGCAGTGTCTCCTTCATC 0: 1
1: 2
2: 2
3: 39
4: 403
Right 1163219188 19:15902409-15902431 GGCTGGCCTCCAAGATCTTCTGG No data
1163219183_1163219190 3 Left 1163219183 19:15902385-15902407 CCACCTGCAGTGTCTCCTTCATC 0: 1
1: 2
2: 2
3: 39
4: 403
Right 1163219190 19:15902411-15902433 CTGGCCTCCAAGATCTTCTGGGG No data
1163219183_1163219193 28 Left 1163219183 19:15902385-15902407 CCACCTGCAGTGTCTCCTTCATC 0: 1
1: 2
2: 2
3: 39
4: 403
Right 1163219193 19:15902436-15902458 CAGAGCAGAACCGCCTGACCAGG 0: 1
1: 2
2: 1
3: 15
4: 109
1163219183_1163219189 2 Left 1163219183 19:15902385-15902407 CCACCTGCAGTGTCTCCTTCATC 0: 1
1: 2
2: 2
3: 39
4: 403
Right 1163219189 19:15902410-15902432 GCTGGCCTCCAAGATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163219183 Original CRISPR GATGAAGGAGACACTGCAGG TGG (reversed) Intergenic
900085274 1:890739-890761 GAGGATGGAGAGACTGCAGGGGG + Intergenic
901151340 1:7104832-7104854 GATAATGGAGAGACTGCATGGGG + Intronic
901707694 1:11088557-11088579 GATGAAGCAAATACTGCAGTTGG + Intronic
901825829 1:11860247-11860269 GATGAAGGAGGCACTGGGAGAGG - Intergenic
902874555 1:19332971-19332993 GTTGAACGAGACACTGTATGGGG + Intergenic
903393549 1:22982135-22982157 GCTGGAGGAGACACTGCAGAAGG + Intergenic
903405720 1:23093967-23093989 GATGAAGGAGAAACTTGAAGAGG - Exonic
905032547 1:34897276-34897298 GAAGAAGGAGAAAGAGCAGGAGG + Intronic
906945481 1:50290850-50290872 AATGTAGGAGACAATGGAGGAGG + Intergenic
907969053 1:59362696-59362718 CATGAAGGAGACAGTGCTGTGGG - Intronic
908438880 1:64133481-64133503 GAAGGAGGAGACCCTGGAGGTGG + Intronic
910061784 1:83102587-83102609 AATGAGGGAGACACAGGAGGGGG + Intergenic
911742684 1:101404276-101404298 TATAAAGAAGACACTGCAGCTGG - Intergenic
912264226 1:108139331-108139353 GAAGCAGCAGGCACTGCAGGAGG + Intronic
912904566 1:113690309-113690331 GATAAATGAGGCACTGAAGGTGG + Intergenic
913064136 1:115233934-115233956 GAGGAAGGGGACACTCCAGCAGG + Intergenic
913598454 1:120400135-120400157 AATGAAGCTGACACAGCAGGGGG + Intergenic
914088873 1:144479183-144479205 AATGAAGCTGACACAGCAGGGGG - Intergenic
914309739 1:146455028-146455050 AATGAAGCTGACACAGCAGGGGG + Intergenic
914511971 1:148341709-148341731 AATGAAGCTGACACAGCAGGGGG - Intergenic
914592371 1:149118112-149118134 AATGAAGCTGACACAGCAGGGGG - Intergenic
914829569 1:151160828-151160850 GTTGAAAGAGAAACTTCAGGGGG - Exonic
916074988 1:161195490-161195512 GATGAAGCGGGCACTGCAGGGGG + Exonic
916569432 1:166012288-166012310 GGAGTAGGAGACACTGTAGGAGG - Intergenic
918827833 1:189349592-189349614 GATTAATGAGAAACTGCAAGGGG - Intergenic
920339245 1:205265359-205265381 TAGGAAGGAGCCACGGCAGGTGG + Intronic
920345300 1:205302449-205302471 GATGAAGTCCACACAGCAGGCGG + Exonic
922685761 1:227637815-227637837 GAGGCAGGAGAGACTGGAGGAGG + Intronic
923337018 1:232979465-232979487 GAGGAAAGAGACACTGATGGAGG - Exonic
924516342 1:244769127-244769149 GCTGAAGGAGATACTGAAGAGGG - Intergenic
924708238 1:246515100-246515122 GATGAAGGAATCGCTCCAGGAGG - Intergenic
924855324 1:247869718-247869740 TATCAAGGAGACAGTGTAGGGGG + Intronic
1063891968 10:10639838-10639860 AATGAAGGAGAGACTGAAGGAGG + Intergenic
1065019255 10:21489433-21489455 GATGAAGGAAACAGTTTAGGTGG - Intergenic
1065278842 10:24114210-24114232 GGTGAAGGAAACACTCCAGAAGG + Intronic
1065434837 10:25695317-25695339 GTGGAAGGAGAGGCTGCAGGAGG - Intergenic
1068558491 10:58484975-58484997 GATGCAGAAGAGACTGTAGGTGG + Intergenic
1069704127 10:70446938-70446960 GATAAAGTAGAAACAGCAGGAGG - Intronic
1069796110 10:71053047-71053069 GCTGAATGAGACACTGTGGGTGG + Intergenic
1070685307 10:78476101-78476123 GAATAAGGAGAGACTGGAGGAGG - Intergenic
1071515439 10:86293724-86293746 GGGGGAGGAGACACTGCAGCTGG + Intronic
1074120060 10:110487498-110487520 GCTGAAGGAGACAGGGGAGGCGG - Intergenic
1075709050 10:124521049-124521071 GGAGAAGGGGACAGTGCAGGAGG - Intronic
1075859305 10:125661237-125661259 GATGGAGCAGACACAGGAGGGGG + Intronic
1076062753 10:127426583-127426605 GATCAAGAAGACACTGCCTGGGG + Intronic
1076199962 10:128550416-128550438 GCTGAAAGGGGCACTGCAGGGGG - Intergenic
1076402901 10:130195069-130195091 GAGCAAGGGGACACCGCAGGAGG - Intergenic
1076498898 10:130919418-130919440 TAGGAAGGAGCCACTTCAGGAGG - Intergenic
1076667566 10:132101901-132101923 CATGAAGGGGACTCTCCAGGGGG - Intergenic
1078163399 11:8862011-8862033 GATTATGGAGACACAGAAGGGGG + Intronic
1078707539 11:13759580-13759602 GATAAGGGAGAGACTGGAGGTGG - Intergenic
1080951687 11:37041080-37041102 GATGAGTGAGATGCTGCAGGTGG + Intergenic
1084035687 11:66508878-66508900 GAGGAAGGAAATACTACAGGGGG - Intronic
1084710793 11:70842732-70842754 GCTAAAGGAGACACTGCTGGAGG + Intronic
1084955220 11:72687612-72687634 GATGAGGGACACAATGAAGGGGG + Intronic
1085300058 11:75452726-75452748 GATGAAGTAGACATAGCAGATGG + Intronic
1085453914 11:76655240-76655262 GGTGAAGGAGATTGTGCAGGTGG + Intergenic
1085641827 11:78197602-78197624 GAGGAAGGAGATACTCCAAGTGG - Intronic
1085779300 11:79393934-79393956 GAAGAGGGTGACACTGAAGGAGG + Intronic
1086833506 11:91594766-91594788 GATGAGAGAGACAGTGAAGGGGG - Intergenic
1087130505 11:94665760-94665782 GATGAGGAAGACTCTGCTGGTGG + Intergenic
1087268121 11:96083156-96083178 GATAAAGAACACACTGGAGGGGG - Intronic
1087973618 11:104516684-104516706 GTTGAAGGAGAAATAGCAGGAGG - Intergenic
1089029792 11:115313766-115313788 GAGGAAGGAGAAAGTACAGGAGG - Intronic
1089138933 11:116271102-116271124 GATGAAGTAGAAACTGCAGTGGG - Intergenic
1089254372 11:117186587-117186609 GAAGAAGAAGACCCTGCTGGTGG + Exonic
1089286329 11:117410148-117410170 GGGGAAGGAGACATTGCAGGTGG + Intronic
1089645095 11:119873771-119873793 GCTGAAAGTGACACTGAAGGAGG - Intergenic
1089742526 11:120594586-120594608 GATCAAGAAGACAGTGCAAGAGG - Intronic
1089773383 11:120819158-120819180 GAGGAAGGAAGCCCTGCAGGCGG - Intronic
1090279115 11:125441115-125441137 CATGAAGGAGACGCTGCTGCTGG + Intergenic
1091025467 11:132137270-132137292 GATGGAGGAGAGCCTGCAGATGG + Intronic
1091637850 12:2211558-2211580 GAAGAAGGAGAGTCTGCTGGTGG - Intronic
1092098836 12:5866298-5866320 GATGAAGTGGACCCTGCAGATGG + Intronic
1093244867 12:16723767-16723789 GAAGAGGGAGACACTTCAGGAGG + Intergenic
1093521186 12:20051921-20051943 GATGAAGGAGTCAGTGCAGGAGG + Intergenic
1095742360 12:45621253-45621275 GAGGAAGGAGATGCTGCAGGGGG + Intergenic
1095948426 12:47767059-47767081 GAGGAAGGCGAAGCTGCAGGAGG + Intronic
1097118505 12:56716662-56716684 GATGGAGGAGTCACAGCTGGAGG + Intronic
1097118531 12:56716764-56716786 GTGGAAGGAGTCACTGCTGGGGG + Intronic
1097376087 12:58844565-58844587 GAGGAAGGAGACAATACAGCAGG + Intergenic
1100392943 12:94159776-94159798 GAAGAAGGAAAACCTGCAGGAGG + Intronic
1100529780 12:95452625-95452647 GATGAAGGAGAGAAGGCAGAAGG - Intergenic
1102152520 12:110698681-110698703 GAGGAAGGAGACGCAGGAGGAGG - Intronic
1102305928 12:111804376-111804398 GAAGAGGGAGAGACTTCAGGGGG + Intronic
1102530249 12:113541039-113541061 GATGAGGGAAAGATTGCAGGAGG + Intergenic
1103564415 12:121808302-121808324 CGTGAATGAGACCCTGCAGGTGG + Exonic
1103904065 12:124318553-124318575 GAGGGAGGAGAAGCTGCAGGAGG - Intergenic
1105516337 13:21094218-21094240 GAGGAATGAGCCACTGCACGCGG + Intergenic
1105887283 13:24652710-24652732 GATGATGGAGACACAGAAGTGGG - Intergenic
1107773174 13:43810441-43810463 AAGGAAGGCGACACTGCAAGGGG + Intergenic
1112191277 13:97180259-97180281 GATAAAGCAGATACTGGAGGAGG + Intergenic
1112336595 13:98522004-98522026 GAGGAAGGAGAGAGTGGAGGAGG - Intronic
1113788607 13:113015800-113015822 GAGGAAGGAGAGAAAGCAGGGGG + Intronic
1114500112 14:23162257-23162279 GAGGAAAGGGACACTGCAGCGGG + Intronic
1114643430 14:24240143-24240165 GACGGAGGACACACTGTAGGAGG + Exonic
1116774920 14:49167999-49168021 GATGAAGAAGAACCTGCTGGTGG + Intergenic
1119031990 14:71200009-71200031 CATAAGGGAGACAGTGCAGGAGG + Intergenic
1121854471 14:97254208-97254230 AGTGAAGGAGACACAGAAGGAGG - Intergenic
1122468615 14:101950859-101950881 GATGATAGAGACACTGAGGGTGG - Intergenic
1124532139 15:30517522-30517544 GGTGGAGGAGAAAATGCAGGAGG + Intergenic
1124766514 15:32490123-32490145 GGTGGAGGAGAAAATGCAGGAGG - Intergenic
1125301047 15:38253136-38253158 GATGGAGGAGCAACAGCAGGCGG - Exonic
1126607205 15:50490329-50490351 GATGAAGGAGCCATTTCCGGTGG - Exonic
1127155892 15:56123959-56123981 GTTGAAAGAGACACTGAAGAAGG - Intronic
1127327285 15:57907983-57908005 GAGGATGGAGACAGTGAAGGGGG + Intergenic
1127737539 15:61858185-61858207 AATGAAGGAGACATTCTAGGTGG - Intronic
1128015366 15:64340533-64340555 GATGTGGTAGAGACTGCAGGTGG + Intronic
1128939546 15:71777310-71777332 GGTGCAGGAGGCACAGCAGGCGG - Exonic
1129284647 15:74514757-74514779 TATGCAGAAGAAACTGCAGGCGG + Intergenic
1131249933 15:90823634-90823656 GCTGAAGGTCACACAGCAGGTGG - Intergenic
1131411399 15:92210890-92210912 GATGAAGGAGAAAAGGCAGAAGG + Intergenic
1132085665 15:98906535-98906557 GCTGCAGGTGACACTGCTGGAGG - Intronic
1132415400 15:101615428-101615450 GACAAAGGAGACACTGCGGAAGG + Intergenic
1132429996 15:101752516-101752538 GAACAAGGAGACACTCCTGGAGG + Intergenic
1132430092 15:101753412-101753434 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430132 15:101753756-101753778 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430192 15:101754282-101754304 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430242 15:101754717-101754739 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430299 15:101755243-101755265 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430356 15:101755769-101755791 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430396 15:101756104-101756126 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430463 15:101756721-101756743 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430520 15:101757247-101757269 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430570 15:101757676-101757698 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430619 15:101758111-101758133 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430715 15:101758982-101759004 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430782 15:101759599-101759621 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430869 15:101760372-101760394 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132430936 15:101760989-101761011 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431032 15:101761859-101761881 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431130 15:101762755-101762777 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431199 15:101763372-101763394 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431251 15:101763807-101763829 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431309 15:101764333-101764355 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1132431338 15:101764586-101764608 GAAGAAGAAGACACTCCTGGAGG + Intergenic
1133181394 16:4057450-4057472 GATGATGGTGTCACTGCAGCCGG - Intronic
1133689727 16:8201693-8201715 GATGGAGGAGGCAATGCAGGAGG - Intergenic
1133752649 16:8736646-8736668 GAAGAAGGAGCCAGTGCAAGTGG - Intronic
1133767783 16:8849765-8849787 GAGGCAGCAGACAGTGCAGGAGG - Intergenic
1134097868 16:11431036-11431058 GCAGAAGGAGACACTTCAAGAGG - Exonic
1134109942 16:11508937-11508959 GCTGAAGGAAGCACTGGAGGGGG - Intronic
1134475249 16:14568061-14568083 TATGAAAGAAACACAGCAGGCGG - Intronic
1134628786 16:15741858-15741880 GCTGCAGGTGACACGGCAGGAGG - Exonic
1134860812 16:17558763-17558785 AATGAAAAAGATACTGCAGGAGG + Intergenic
1137569573 16:49556657-49556679 GATAAAGAAGTAACTGCAGGTGG - Intronic
1137886609 16:52111236-52111258 GATGAAGTTCATACTGCAGGAGG - Intergenic
1138082361 16:54102742-54102764 GGAGAAGGAGACAGTGCAGGCGG - Intronic
1138520808 16:57569897-57569919 GATGATGGTGATAGTGCAGGTGG - Intronic
1139099000 16:63743515-63743537 GACCAACGAGACACAGCAGGAGG + Intergenic
1140821652 16:78668620-78668642 GGTGAAGGAGTGACAGCAGGGGG + Intronic
1141185794 16:81786124-81786146 GATCATGGAGACGCGGCAGGTGG + Exonic
1141391619 16:83669219-83669241 GATGAAAGAGAAACTGCCCGGGG - Intronic
1142228222 16:88887670-88887692 CTTGAAGGAGGCACTGCCGGAGG - Intronic
1143204955 17:5134882-5134904 GATGATGGAGTCGCTCCAGGAGG + Intronic
1143281287 17:5756514-5756536 GTAGAAGGAGACACTGTAGCAGG - Intergenic
1143413569 17:6728321-6728343 GCTGAAAGAGGCACTGCAGAGGG + Intergenic
1143690684 17:8561919-8561941 GATGAAGGAGACAGGGCTGCAGG + Intronic
1143704265 17:8686249-8686271 GAGAAAGGAGACAGTGTAGGAGG - Intergenic
1144059038 17:11565799-11565821 GTTCAAAGTGACACTGCAGGCGG - Intergenic
1144825262 17:18102173-18102195 GGCCAAGGAGACACTGCAGGAGG + Intronic
1145760635 17:27423556-27423578 GATGAAGGAGTCGCTCCAGAAGG + Intergenic
1145798401 17:27668739-27668761 GATGAAGGAGTCACTCCAGGAGG - Intergenic
1146160687 17:30557872-30557894 GATGAAGGAGTCGCTCCAGGAGG + Exonic
1146165518 17:30585216-30585238 GATGAAGGAGAAAGTGTTGGAGG + Intergenic
1146494518 17:33309587-33309609 GAGGAAGGGGACAGTGGAGGTGG - Intronic
1146674267 17:34762174-34762196 GATGAAGGAGACAGAGCACTGGG - Intergenic
1146843703 17:36170943-36170965 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146856010 17:36258877-36258899 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146864610 17:36329498-36329520 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1146871916 17:36382788-36382810 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146879277 17:36433873-36433895 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1146883207 17:36455018-36455040 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1146949672 17:36897207-36897229 GATGAAGGAAGCACATCAGGAGG - Intergenic
1147067470 17:37930086-37930108 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147074802 17:37983412-37983434 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147079001 17:38009647-38009669 GATGAAGGAGTCGCCCCAGGAGG + Intronic
1147086325 17:38062958-38062980 GATGAAGGAGTCGCCCCAGGAGG - Intronic
1147094938 17:38133582-38133604 GATGAAGGAGTCGCCCCAGGAGG + Intergenic
1147102271 17:38186921-38186943 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1148332311 17:46819956-46819978 GGTGAAGGAAGCACTGCCGGTGG + Intronic
1148359306 17:46998637-46998659 GGGGAAGGAGAAACTGCTGGAGG + Intronic
1148491629 17:48027129-48027151 GAGGAGGGAGACTGTGCAGGAGG - Intronic
1149330401 17:55575650-55575672 GAGGAAGGAGACACCAGAGGGGG + Intergenic
1149627832 17:58092325-58092347 GATGAAAGAGGCAGTCCAGGTGG + Exonic
1149689787 17:58565746-58565768 GATGGAGGAGGCACTGCAAATGG - Exonic
1149846859 17:60013428-60013450 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150029498 17:61717915-61717937 GATGGATTAGACACTGCAGAAGG - Intronic
1150069025 17:62137031-62137053 GCTGAAGGAGACACTGCAGGCGG - Intergenic
1150085207 17:62270005-62270027 GATGAAGGAGTCGCCCCAGGAGG - Intergenic
1150506589 17:65704668-65704690 GATGAAAGAGATACTGCTTGAGG + Intronic
1150872401 17:68927298-68927320 GGTGCATGAGACACTGCAGTGGG + Intronic
1151439993 17:74122288-74122310 GATGAGGAAGACAGTGCAGATGG - Intergenic
1152720439 17:81921030-81921052 GATGAGGGAGTCACTGTGGGTGG - Exonic
1154145207 18:11861251-11861273 GAAGAAGGAGAGCCAGCAGGAGG - Intronic
1156208451 18:34911796-34911818 GATACAGGAGCCACTTCAGGTGG + Intergenic
1156310689 18:35919105-35919127 GATGAAGCAGGCACAGCTGGAGG + Intergenic
1156354844 18:36332065-36332087 GCTGAAGGGAACACTGCAGGAGG - Intronic
1157815560 18:50727393-50727415 GATTAAGGAGGCACTGAGGGAGG + Intronic
1160072874 18:75643587-75643609 GATGGAGCAGAGACTGAAGGAGG - Intergenic
1160725826 19:617431-617453 GCTGAAGGAGACACTGCAGGCGG - Exonic
1161454073 19:4361532-4361554 AATGCAGGAGACCCAGCAGGGGG + Exonic
1161719372 19:5894632-5894654 GATGACGGCGACACAGCAGCCGG - Intronic
1162892735 19:13745814-13745836 GATGAAGCAGACACTTCAACTGG - Intronic
1163182626 19:15615185-15615207 GATCTAGGAAACACTTCAGGAGG - Intergenic
1163219183 19:15902385-15902407 GATGAAGGAGACACTGCAGGTGG - Intergenic
1164560651 19:29289768-29289790 GATGGAGGAAACACTGGATGTGG + Intergenic
1164858641 19:31544976-31544998 GATGAAGGAGAAAGAGAAGGAGG - Intergenic
1165695106 19:37894971-37894993 GATGGAGGAGCCGCTGCTGGTGG + Exonic
1166558418 19:43716732-43716754 GGGCAAGGAGACAATGCAGGAGG + Intronic
1166701139 19:44882326-44882348 GAAGGAGCAGACGCTGCAGGGGG + Exonic
1167569269 19:50276784-50276806 GCTGAAGAAGACTCTGGAGGAGG + Exonic
1167573453 19:50305294-50305316 GATGAAGAAGAGAAAGCAGGGGG + Intronic
1167582319 19:50352565-50352587 GCTGAAGGACACACTGAAGAGGG - Intronic
1168105894 19:54165532-54165554 GCTGAAGCAGACACTGCTGGCGG - Exonic
1168642311 19:58038528-58038550 GTTGCAGGAGGCGCTGCAGGTGG - Intronic
925290112 2:2742134-2742156 GAAGAAGGAGACAGAGCAGTAGG + Intergenic
925389950 2:3487821-3487843 GAAGACAGAGACACTGGAGGAGG - Intergenic
925574839 2:5349801-5349823 GATGAAGCAGACACTTCAGCAGG + Intergenic
925636929 2:5949659-5949681 GGTGAAGAAAGCACTGCAGGTGG - Intergenic
926226498 2:10970866-10970888 ACTGAATGAGACCCTGCAGGAGG + Intergenic
926774654 2:16409882-16409904 GATGATGGAGAAAGTGAAGGAGG - Intergenic
927984718 2:27400935-27400957 GGTCAAGGATACACAGCAGGTGG + Intronic
928943634 2:36752664-36752686 AATGTAGGAGACACTGGAGGAGG - Intronic
929010858 2:37442754-37442776 GAGGAAGAAGACGCTGCAGACGG + Intergenic
929530592 2:42749170-42749192 GAGGAAGGAGACACAGAAGGGGG - Intronic
929600973 2:43204324-43204346 GATGGAGGAGTCACTGCATGGGG - Intergenic
930075580 2:47403203-47403225 GCCGAAGGAGACGCTGCAGTTGG + Exonic
932491721 2:72127054-72127076 GATTGAGGAGCCACTGGAGGAGG + Intergenic
932549076 2:72748376-72748398 GTTGAAAGAGAAACTGCAGGAGG + Intronic
932607536 2:73175351-73175373 GGTGAAGGAGACAGTGCAGAGGG - Intergenic
932840740 2:75079880-75079902 GAAGAAAGAAAGACTGCAGGTGG + Intronic
933377002 2:81492374-81492396 GATGAAGGAGAGAATGCACTGGG + Intergenic
933657415 2:84900703-84900725 GAGGAAAGAGACACTTCAGCAGG + Intronic
933665246 2:84959575-84959597 GAAGAAGGAGACAGTGTATGGGG - Intergenic
935224370 2:101040309-101040331 GAGGAAGGAGAAGCTGCACGCGG - Exonic
936033106 2:109087757-109087779 GAGGAAGCAGATGCTGCAGGTGG + Intergenic
936259647 2:110947858-110947880 GGGCCAGGAGACACTGCAGGAGG - Intronic
937065356 2:119013018-119013040 GGAGAAGCAGACACTGCAGGAGG + Intergenic
937276055 2:120685063-120685085 GCTGGAGGAGAGGCTGCAGGGGG + Intergenic
937531627 2:122835979-122836001 GAGGCATGAGACACTGCAGCAGG + Intergenic
938616936 2:133009019-133009041 GACTAAGGAGACACTCCAGTGGG - Intronic
939382812 2:141457885-141457907 GATGAAGCAGAATTTGCAGGTGG + Intronic
940152461 2:150617367-150617389 GAACAGGGAGAGACTGCAGGTGG - Intergenic
940737154 2:157466504-157466526 GAAGAAAGAAACACTGCAGAAGG + Intronic
941048608 2:160705200-160705222 GATGAAGAAGACACAGAGGGTGG + Intergenic
941468568 2:165858135-165858157 GATGAAGGAAACAGGGAAGGGGG + Intronic
943831649 2:192471779-192471801 AAGGAAGGAGACACTGAAGAGGG + Intergenic
944731176 2:202518990-202519012 GATGAGAGAGTCACTGCAGATGG + Exonic
945830159 2:214774824-214774846 GCTGATGGAGAAACTGCAGCAGG - Intronic
946403609 2:219481481-219481503 TATGAGGGTGACCCTGCAGGTGG - Intronic
948032378 2:234829438-234829460 GATGAAGGTGAGAATGCAGGAGG - Intergenic
948187323 2:236031702-236031724 AATGATGGAGACCCTGCAAGTGG - Intronic
948242204 2:236447068-236447090 GATGAGAGAGTCACTGGAGGAGG - Intronic
948723570 2:239918584-239918606 GATGAGGCTGCCACTGCAGGAGG - Intronic
1169236535 20:3934204-3934226 GCAGAAGGAGACACCACAGGGGG + Intronic
1169652497 20:7885109-7885131 ACTGATGGAGAAACTGCAGGTGG + Intronic
1171277373 20:23869577-23869599 GGTAAAGGAGAAACTGCGGGGGG - Intergenic
1171774214 20:29350436-29350458 GAGGATGGAGAGACTGCAGGGGG - Intergenic
1171816234 20:29788054-29788076 GAGGATGGAGAGACTGCAGGGGG - Intergenic
1173157616 20:40627911-40627933 GAGGGAGGAGACACTGGACGTGG + Intergenic
1173258826 20:41415194-41415216 GAAGGAGCAGACACTTCAGGCGG - Exonic
1174614372 20:51824740-51824762 AATTAGGGAGAGACTGCAGGTGG + Intergenic
1175891850 20:62319201-62319223 GGTGTTGGAGGCACTGCAGGAGG - Intronic
1175892787 20:62322846-62322868 CCTGGAGGAGACACAGCAGGAGG - Intronic
1175995798 20:62811860-62811882 GGTGATGGAGAACCTGCAGGCGG + Intronic
1176051132 20:63120285-63120307 GATGAACGTGACAGTGCTGGAGG - Intergenic
1176964820 21:15200408-15200430 GATGAAGGAGTCAGTGCAGAGGG + Intergenic
1178111849 21:29376818-29376840 GCTCAGGGGGACACTGCAGGAGG - Intronic
1178525433 21:33324741-33324763 GAGGAAGAAGAGAATGCAGGAGG + Intronic
1178530207 21:33369747-33369769 GATGGAGAAGACACTGGATGTGG - Intergenic
1179360256 21:40699839-40699861 GTTGATGGAGAAACTGCAGCAGG + Intronic
1179547424 21:42122165-42122187 GATGATGGAGCCACTGCTGAAGG + Intronic
1180319679 22:11308589-11308611 GAGGACGGAGAGACTGCAAGGGG - Intergenic
1182234384 22:28864058-28864080 CATGAAGGAGAGGCTGCAGTGGG + Intergenic
1182722159 22:32411937-32411959 GATGAGGGAAACTCTGCAAGGGG + Intronic
1182791221 22:32954676-32954698 GATGAACCAGAAACTGCAAGAGG + Intronic
1183269378 22:36851099-36851121 GAAGAAGGAGACAAAGCAAGTGG - Intergenic
1183457323 22:37929948-37929970 GCTCAAGGACACACAGCAGGTGG - Intronic
1184005061 22:41701656-41701678 GATGAATAAGACAGTGCAGCGGG + Intronic
1184884766 22:47336026-47336048 GATGATGGAGATAACGCAGGTGG - Intergenic
1185162366 22:49237721-49237743 GGTGAAGAAGACAGAGCAGGCGG - Intergenic
950410487 3:12833232-12833254 GAGGAAACAGAAACTGCAGGAGG + Intronic
953164197 3:40449982-40450004 GATGAAGGAGCCAGGGCATGTGG - Intergenic
954144519 3:48627930-48627952 GATGATGGTGAGACTGGAGGTGG - Exonic
954381995 3:50224264-50224286 GATAGAGGTGCCACTGCAGGAGG + Intergenic
954396269 3:50295041-50295063 GATGGAGGATACGCTGCGGGTGG - Exonic
954981693 3:54751719-54751741 GATGAATGACACTCAGCAGGTGG - Intronic
955826011 3:62948772-62948794 GATGCCGGGGACAGTGCAGGGGG - Intergenic
956768713 3:72506488-72506510 CAAGAAGGAGAGAGTGCAGGTGG + Intergenic
957561528 3:81828168-81828190 GATGAAGCAGACACTGAAATTGG - Intergenic
957940499 3:86996985-86997007 GGTGAAGGAGACGCTGGAAGAGG + Intergenic
958505073 3:94966648-94966670 TATGAAGAATACACTACAGGAGG - Intergenic
958837471 3:99162674-99162696 AAGGAAGGAGACACTGAAGAGGG + Intergenic
958846429 3:99270499-99270521 CATGAAGGAGTCACTTCAGTGGG - Intergenic
958943438 3:100338309-100338331 GTTGAAAGAGATACTGCAGAAGG - Intronic
959592792 3:108098150-108098172 GAGAAAGGAGAAACTGAAGGAGG + Intergenic
959991824 3:112639173-112639195 GCTGAAGAAGACGCTGCAGGTGG - Exonic
960095563 3:113686395-113686417 AAGGAAGGAGACACTGAAGATGG - Intronic
960945313 3:122962353-122962375 GAAGAAGGAGCTACTGCTGGAGG + Intronic
961534494 3:127561508-127561530 GAAGAAGGAGAATCTGCAGAAGG + Intergenic
961815995 3:129550692-129550714 GAAGAAGGAGGAACTGCTGGTGG - Intronic
962258958 3:133891077-133891099 GATGAAGGGCTCCCTGCAGGAGG + Intronic
962538246 3:136350710-136350732 TATGAAGAAGAAACTGCAGCTGG + Intronic
963972964 3:151449843-151449865 GATGCAGGAGACAATGAAGAAGG + Intronic
964223742 3:154373153-154373175 GATAAAGGAGACAATAAAGGAGG + Intronic
964689805 3:159437589-159437611 GAGGAAGGAGACGGTGGAGGGGG + Intronic
966055119 3:175677615-175677637 GATGAAGGAGTCCCTGGAGGGGG - Intronic
966436979 3:179898183-179898205 GATGAAGGAGATACCGAGGGAGG - Exonic
966723303 3:183085991-183086013 GCTGAAGGAGAGACTGGGGGAGG - Intronic
966750050 3:183313326-183313348 GCAGAAGGAGACACTGGAGGGGG + Intronic
967093726 3:186159392-186159414 CATGCAGGAGACACTGCTGAAGG - Intronic
968316935 3:197732815-197732837 GATGAAGGAGCCACTGAAAGAGG + Intronic
968834108 4:2950116-2950138 GAAGAAGGTGACAGTTCAGGCGG - Exonic
968965491 4:3767244-3767266 GAAGAAGGAGCCGATGCAGGAGG - Exonic
969134142 4:5016525-5016547 GGTAGAGGAGACTCTGCAGGAGG - Intronic
973284797 4:48403349-48403371 GATGATGGAGCCCCTGGAGGAGG - Intronic
973831963 4:54770617-54770639 GAAGAAAGTGAAACTGCAGGGGG - Intergenic
976911988 4:90318853-90318875 GATGAAAGAGACAGTGCTTGAGG + Intronic
978634740 4:110790694-110790716 CGTGAAAGTGACACTGCAGGAGG + Intergenic
979810486 4:125030142-125030164 GATGAAAGCCACATTGCAGGAGG + Intergenic
980528494 4:134019835-134019857 GATGAAAGAGACACTGGGGTTGG + Intergenic
983558641 4:169079932-169079954 AGAGAGGGAGACACTGCAGGTGG + Intergenic
986399996 5:7371289-7371311 GATGATGGAGACAGTGGTGGTGG - Intergenic
987557171 5:19468028-19468050 GAGGCAGGGGAAACTGCAGGAGG - Intergenic
988297994 5:29390826-29390848 GAGGAAGAAGAGACTGCCGGTGG - Intergenic
989002123 5:36772365-36772387 GTTGATGGGGACATTGCAGGTGG - Intergenic
989108772 5:37887552-37887574 GAAGAATGAGACACTGGAGCAGG - Intergenic
989176959 5:38537333-38537355 AATATAGGAGACATTGCAGGGGG - Intronic
991262963 5:64686566-64686588 GATGAAGAGGACACTGCAGATGG - Intergenic
991443041 5:66671319-66671341 GATGCTGGAAACACAGCAGGAGG - Intronic
992049791 5:72931693-72931715 GGTGAAGGAGAAAAGGCAGGAGG + Intergenic
992876794 5:81064250-81064272 AATAAAGTAGACACTGTAGGAGG - Intronic
999127645 5:149258269-149258291 GCTGAAGGAGGCAGGGCAGGCGG - Exonic
1000542987 5:162564068-162564090 GATGAAGGAAACCATGCATGTGG + Intergenic
1000641590 5:163709356-163709378 GCTGGAGGAGAAACTGAAGGAGG - Intergenic
1000796583 5:165671900-165671922 GATGAGGAAGACACTTCAGAGGG - Intergenic
1001736235 5:174005489-174005511 GATGAAGGACACATTGCCTGGGG + Exonic
1001738025 5:174022953-174022975 CCTGAAGGAGGCACAGCAGGAGG + Intergenic
1001829595 5:174774327-174774349 GATGAAGGCAAAACTACAGGAGG - Intergenic
1001951876 5:175821908-175821930 GATAAAGGAGACACTGATGGGGG + Intronic
1002190546 5:177475158-177475180 GAGGAGGGAGACCCTGCAGCCGG + Intergenic
1002471693 5:179439366-179439388 GATGAAAGGGACACTCAAGGGGG + Intergenic
1002821872 6:733343-733365 GATCAAGGAGATTCTGTAGGAGG + Intergenic
1003129220 6:3381123-3381145 GATGAAGGAGACACAGAAAGTGG - Intronic
1004149169 6:13098626-13098648 GAGGAAGGAGACACAGAAGGTGG - Intronic
1004258234 6:14084702-14084724 GATGAATGAGACAAAGGAGGTGG + Intergenic
1005212063 6:23477600-23477622 TATGAAGCAAAAACTGCAGGAGG + Intergenic
1006387085 6:33737246-33737268 TGCGAAGGAGACACTGCAAGGGG + Intronic
1006551956 6:34831743-34831765 GACAAAGGTGACAGTGCAGGGGG - Intronic
1008302586 6:49859334-49859356 GGTGCAGCAGACACTTCAGGTGG - Intronic
1008606094 6:53141220-53141242 AATGCAGGAGACACTGTAGTAGG - Intronic
1009744693 6:67797988-67798010 ACTGAAAGAGACACTGCAGAGGG + Intergenic
1011091404 6:83605687-83605709 GCTGGAGGAGCCACTGCATGGGG - Exonic
1011374635 6:86675972-86675994 GGTGAAGGAGAAAATGCAGAAGG - Intergenic
1011650606 6:89503007-89503029 GATGAAAGAGACATTGGAAGGGG - Intronic
1011890754 6:92156452-92156474 AATCTAGAAGACACTGCAGGTGG + Intergenic
1013141579 6:107341252-107341274 GATGAAGGAGACATTGGGGAGGG + Intronic
1013677562 6:112482623-112482645 GAGGAAGAAGAAACTGGAGGTGG + Intergenic
1014202649 6:118622816-118622838 GATGAAGGAGAAGCAGCAGAAGG + Intronic
1015020796 6:128472045-128472067 GATGAAGGAGACAGTTCAAGAGG + Intronic
1016225767 6:141734517-141734539 GGAGAAGGAGACAGTTCAGGTGG + Intergenic
1017152252 6:151291094-151291116 GGTGAAGGGGACACTGGATGAGG - Intronic
1017497010 6:154992191-154992213 CATGGGAGAGACACTGCAGGAGG + Intronic
1017784793 6:157746651-157746673 GAGGAAGGAGCCTTTGCAGGGGG + Intronic
1018748217 6:166779459-166779481 GATGACTGAGACATTGGAGGAGG + Intronic
1019487540 7:1296249-1296271 GGTAAAGGAGACACTGCTGTCGG - Intergenic
1019874012 7:3792678-3792700 GATGGATGGGAGACTGCAGGAGG - Intronic
1020263913 7:6547766-6547788 GATGGAGGAGACACTCCTGAGGG + Intronic
1020435004 7:8152662-8152684 GATGAAGGAGATAATGGTGGTGG - Intronic
1021412962 7:20348895-20348917 GATGAAGGAGAAACAGTAGCTGG + Intronic
1022209070 7:28190807-28190829 GATGGAGAGAACACTGCAGGAGG + Intergenic
1023894139 7:44418103-44418125 AATGAAGGAGAGACTGCAGAGGG + Intronic
1024047272 7:45593230-45593252 GATGAATGTGACCGTGCAGGTGG + Intronic
1024139238 7:46445191-46445213 GATTAAGGTGGCACAGCAGGAGG + Intergenic
1024611269 7:51066331-51066353 GAGGAAGGAGAAAGTGGAGGAGG - Intronic
1024800964 7:53077561-53077583 GCTGCAGGAGAGACTGGAGGAGG + Intergenic
1024886839 7:54152063-54152085 GCTGCAGGAGGCACTCCAGGAGG + Intergenic
1026685595 7:72506827-72506849 TATGAAGGGGACACAGCATGGGG + Intergenic
1028261124 7:88666829-88666851 CATGCAGCAAACACTGCAGGAGG + Intergenic
1028522149 7:91743147-91743169 GCTGAAAGAGACACTGAAGAGGG - Intronic
1029169765 7:98622188-98622210 AATAAATCAGACACTGCAGGTGG - Intronic
1029419181 7:100463590-100463612 GATGGAGAAGACTCTCCAGGTGG - Exonic
1029545315 7:101207435-101207457 GGGGAATGAGACGCTGCAGGAGG - Intronic
1032142396 7:129344647-129344669 TATGAAGGAAACAAAGCAGGTGG + Intronic
1032472011 7:132185387-132185409 GATGAAGGTGTCGGTGCAGGTGG - Exonic
1033499768 7:141936281-141936303 GCTGAAAGAGGCACTGCAGAGGG + Intronic
1033600154 7:142883537-142883559 GATGACGGAGATAAGGCAGGTGG + Intronic
1035029336 7:155847265-155847287 GAAGAAGGACACACTGTGGGGGG + Intergenic
1035612970 8:980674-980696 GAGGAAGGAGAGACTCCAGCAGG + Intergenic
1037893207 8:22635044-22635066 GATGCAGGAGAGGCAGCAGGAGG - Intronic
1039761468 8:40581215-40581237 GTTTAGGGAGACACTGCAGATGG + Exonic
1040791436 8:51234661-51234683 GATGAAGGAGCAACTGAAGAAGG + Intergenic
1040824470 8:51606361-51606383 CATGAAGGATCCACTGCTGGCGG - Intronic
1041876274 8:62690879-62690901 GTGGAAGGAGACACTGCGGATGG + Intronic
1042025408 8:64417460-64417482 GATTAAGAAGCCACTTCAGGAGG + Intergenic
1044294301 8:90509989-90510011 GATGATGGAGACATTGAAGGAGG + Intergenic
1046335400 8:112780550-112780572 AAGGAAAGAGACACTGAAGGGGG + Intronic
1047465486 8:125109004-125109026 GAGGAAGGAAAGACTTCAGGTGG + Intronic
1048118656 8:131554703-131554725 GTTGAAAGAGACACTGAAGATGG + Intergenic
1048288695 8:133163344-133163366 GATGAAAGAGAAAGTGTAGGAGG - Intergenic
1048617273 8:136090958-136090980 TATGAAGGAGACACGGCACAGGG - Intergenic
1048845809 8:138602781-138602803 GAAGAAAGAGACATTCCAGGTGG - Intronic
1048918825 8:139209435-139209457 GCTGAAGGACACACTGGAGAAGG - Intergenic
1051049706 9:12916486-12916508 GATGAAGGAGGCAGTGAGGGAGG - Intergenic
1051663773 9:19449427-19449449 GACAAATGAGAAACTGCAGGGGG - Intronic
1052017490 9:23486130-23486152 TATGAAGCAGACACCACAGGAGG + Intergenic
1052384252 9:27806162-27806184 AAGGAAGAAGACACTGCGGGTGG + Intergenic
1055502550 9:76916089-76916111 GAGGAAGGACACCTTGCAGGGGG + Intergenic
1056128232 9:83557767-83557789 TATGATGGAAACACTGCAGGGGG + Intergenic
1056672408 9:88641837-88641859 GAGGATGGAGACACAGCAAGAGG - Intergenic
1056760022 9:89407885-89407907 GATGAATGAGACTGTGCAGTGGG - Intronic
1057699834 9:97355863-97355885 GATGATGGAGAAAATCCAGGGGG + Intronic
1057861284 9:98642917-98642939 GGCGAGGGAGACAGTGCAGGAGG - Intronic
1058108439 9:101002710-101002732 GATGGAGCTGACAATGCAGGTGG + Intergenic
1058884119 9:109310324-109310346 GATGAAAGACAAACTTCAGGAGG + Intronic
1058914207 9:109549996-109550018 AAAGAAGGAGACAAAGCAGGAGG + Intergenic
1059002874 9:110368151-110368173 GATGGAGGAGACCCTGGAAGAGG + Intronic
1060039953 9:120291641-120291663 TATTAACAAGACACTGCAGGGGG + Intergenic
1061506045 9:131032344-131032366 GATGCAGGGGACCCGGCAGGAGG - Intronic
1062187053 9:135223779-135223801 AATGAAGGAGTCACCCCAGGGGG + Intergenic
1062352932 9:136148033-136148055 GATCAAGGCCACACAGCAGGTGG + Intergenic
1062376254 9:136263162-136263184 GAGGGAGGGGACACTGCTGGGGG - Intergenic
1062482689 9:136759702-136759724 GAGGATGGAGAGACTCCAGGTGG + Exonic
1062634387 9:137482596-137482618 CACGGAGGAGACCCTGCAGGTGG - Intronic
1062710891 9:137974663-137974685 GATAAAGCAGACACTGGAAGAGG - Intronic
1203367908 Un_KI270442v1:274339-274361 GAGGATGGAGAGACTGCAGTGGG - Intergenic
1185642062 X:1593870-1593892 CATGAACGAGACCCTGCCGGGGG + Exonic
1186084697 X:5974385-5974407 GACTGAGGAGACACTGCAGTTGG + Intronic
1189497132 X:41518968-41518990 GAGGAAGGAGAGACCACAGGTGG + Intronic
1189504201 X:41594664-41594686 AGTCAAGGAGACACTGCAGAAGG + Intronic
1189854257 X:45208253-45208275 GCTGAAAGAGGCACTGAAGGGGG - Intergenic
1189854540 X:45210326-45210348 GCTGAAAGAGGCACTGAAGGGGG - Intergenic
1190455984 X:50628197-50628219 GAAGGAGGAGCCACTGCAGTTGG - Intronic
1190597266 X:52062196-52062218 GAGAAATGAGACTCTGCAGGAGG - Intronic
1190611558 X:52191877-52191899 GAGAAATGAGACTCTGCAGGAGG + Intronic
1190803668 X:53814702-53814724 GAGGCAGGAGACAAGGCAGGAGG - Intergenic
1191602006 X:63018564-63018586 GATGAAGGACCCACTTGAGGAGG - Intergenic
1196096897 X:111809579-111809601 GCTGAAAGAGACACTGAAGAGGG - Intronic
1196495233 X:116317265-116317287 GCTGAAAGAGACACTGCAGTGGG + Intergenic
1197729661 X:129798873-129798895 TAGGAAGGAGACACAGAAGGTGG - Intergenic
1198767553 X:140094406-140094428 GATGAAGGAGGTAGAGCAGGTGG + Intergenic
1198770778 X:140127504-140127526 GCTGAAAGAGACACTGAAGAGGG - Intergenic
1200000459 X:153057157-153057179 GTTTGAGGAGACACTCCAGGAGG + Exonic
1200049615 X:153421836-153421858 GATGGAGGAGCCAGGGCAGGCGG - Intergenic
1200852111 Y:7893970-7893992 GCTAAAGGACACACTGAAGGGGG - Intergenic
1201894907 Y:18982864-18982886 GAAGAAGGAGAAAGTGTAGGAGG + Intergenic