ID: 1163223337

View in Genome Browser
Species Human (GRCh38)
Location 19:15937264-15937286
Sequence CTGTCCTTGCAGAGGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163223337_1163223341 -9 Left 1163223337 19:15937264-15937286 CCCTACTCCCTCTGCAAGGACAG No data
Right 1163223341 19:15937278-15937300 CAAGGACAGACCTCACCTACTGG No data
1163223337_1163223346 17 Left 1163223337 19:15937264-15937286 CCCTACTCCCTCTGCAAGGACAG No data
Right 1163223346 19:15937304-15937326 TTCCATCCCTGTTAGGCTCAGGG No data
1163223337_1163223344 10 Left 1163223337 19:15937264-15937286 CCCTACTCCCTCTGCAAGGACAG No data
Right 1163223344 19:15937297-15937319 CTGGCAGTTCCATCCCTGTTAGG No data
1163223337_1163223345 16 Left 1163223337 19:15937264-15937286 CCCTACTCCCTCTGCAAGGACAG No data
Right 1163223345 19:15937303-15937325 GTTCCATCCCTGTTAGGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163223337 Original CRISPR CTGTCCTTGCAGAGGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr