ID: 1163225122

View in Genome Browser
Species Human (GRCh38)
Location 19:15955163-15955185
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163225117_1163225122 21 Left 1163225117 19:15955119-15955141 CCTGGTATTGTATTTATTGTGGC No data
Right 1163225122 19:15955163-15955185 AGATGCAGTCCTTCCTACTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163225122 Original CRISPR AGATGCAGTCCTTCCTACTA GGG Intergenic
No off target data available for this crispr