ID: 1163226405

View in Genome Browser
Species Human (GRCh38)
Location 19:15964449-15964471
Sequence CCTCACCTGCTCCCATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163226398_1163226405 18 Left 1163226398 19:15964408-15964430 CCTATCAGAGTGGATTAAAGGTC No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data
1163226400_1163226405 -8 Left 1163226400 19:15964434-15964456 CCTGCCCAACTCTTACCTCACCT No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data
1163226393_1163226405 30 Left 1163226393 19:15964396-15964418 CCCACACTCCAGCCTATCAGAGT No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data
1163226396_1163226405 22 Left 1163226396 19:15964404-15964426 CCAGCCTATCAGAGTGGATTAAA No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data
1163226394_1163226405 29 Left 1163226394 19:15964397-15964419 CCACACTCCAGCCTATCAGAGTG No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data
1163226399_1163226405 -7 Left 1163226399 19:15964433-15964455 CCCTGCCCAACTCTTACCTCACC No data
Right 1163226405 19:15964449-15964471 CCTCACCTGCTCCCATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163226405 Original CRISPR CCTCACCTGCTCCCATGGCC TGG Intergenic
No off target data available for this crispr