ID: 1163228021

View in Genome Browser
Species Human (GRCh38)
Location 19:15978907-15978929
Sequence GGATCTGGAACTGGACTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228021_1163228032 28 Left 1163228021 19:15978907-15978929 CCAAGCAGTCCAGTTCCAGATCC No data
Right 1163228032 19:15978958-15978980 TGGTTTGGCTTTGAATCTCAAGG No data
1163228021_1163228029 8 Left 1163228021 19:15978907-15978929 CCAAGCAGTCCAGTTCCAGATCC No data
Right 1163228029 19:15978938-15978960 TGGGTGATGTCTGCTTCCAATGG No data
1163228021_1163228030 13 Left 1163228021 19:15978907-15978929 CCAAGCAGTCCAGTTCCAGATCC No data
Right 1163228030 19:15978943-15978965 GATGTCTGCTTCCAATGGTTTGG No data
1163228021_1163228033 29 Left 1163228021 19:15978907-15978929 CCAAGCAGTCCAGTTCCAGATCC No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228021 Original CRISPR GGATCTGGAACTGGACTGCT TGG (reversed) Intergenic
No off target data available for this crispr