ID: 1163228028

View in Genome Browser
Species Human (GRCh38)
Location 19:15978934-15978956
Sequence TGGAAGCAGACATCACCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228028_1163228035 11 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228035 19:15978968-15978990 TTGAATCTCAAGGGTCAAAAGGG No data
1163228028_1163228034 10 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228034 19:15978967-15978989 TTTGAATCTCAAGGGTCAAAAGG No data
1163228028_1163228032 1 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228032 19:15978958-15978980 TGGTTTGGCTTTGAATCTCAAGG No data
1163228028_1163228033 2 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228028_1163228036 15 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228036 19:15978972-15978994 ATCTCAAGGGTCAAAAGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228028 Original CRISPR TGGAAGCAGACATCACCCAA AGG (reversed) Intergenic
No off target data available for this crispr