ID: 1163228033

View in Genome Browser
Species Human (GRCh38)
Location 19:15978959-15978981
Sequence GGTTTGGCTTTGAATCTCAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228027_1163228033 7 Left 1163228027 19:15978929-15978951 CCGTGCCTTTGGGTGATGTCTGC No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228022_1163228033 20 Left 1163228022 19:15978916-15978938 CCAGTTCCAGATCCCGTGCCTTT No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228025_1163228033 14 Left 1163228025 19:15978922-15978944 CCAGATCCCGTGCCTTTGGGTGA No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228021_1163228033 29 Left 1163228021 19:15978907-15978929 CCAAGCAGTCCAGTTCCAGATCC No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228028_1163228033 2 Left 1163228028 19:15978934-15978956 CCTTTGGGTGATGTCTGCTTCCA No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228026_1163228033 8 Left 1163228026 19:15978928-15978950 CCCGTGCCTTTGGGTGATGTCTG No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data
1163228020_1163228033 30 Left 1163228020 19:15978906-15978928 CCCAAGCAGTCCAGTTCCAGATC No data
Right 1163228033 19:15978959-15978981 GGTTTGGCTTTGAATCTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228033 Original CRISPR GGTTTGGCTTTGAATCTCAA GGG Intergenic
No off target data available for this crispr