ID: 1163228159

View in Genome Browser
Species Human (GRCh38)
Location 19:15979532-15979554
Sequence GTTCTCTTGGAGGCCAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228159_1163228162 -5 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228162 19:15979550-15979572 AGAACCTGCTACCAGAGTGTAGG No data
1163228159_1163228167 16 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228167 19:15979571-15979593 GGTCTCGTGTTCAGCCAGGGAGG No data
1163228159_1163228165 12 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228165 19:15979567-15979589 TGTAGGTCTCGTGTTCAGCCAGG No data
1163228159_1163228168 24 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228168 19:15979579-15979601 GTTCAGCCAGGGAGGCAGTCAGG No data
1163228159_1163228169 25 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228169 19:15979580-15979602 TTCAGCCAGGGAGGCAGTCAGGG No data
1163228159_1163228166 13 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228159 Original CRISPR GTTCTCTTGGAGGCCAACTA TGG (reversed) Intergenic