ID: 1163228164

View in Genome Browser
Species Human (GRCh38)
Location 19:15979561-15979583
Sequence TGAACACGAGACCTACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228164_1163228169 -4 Left 1163228164 19:15979561-15979583 CCAGAGTGTAGGTCTCGTGTTCA No data
Right 1163228169 19:15979580-15979602 TTCAGCCAGGGAGGCAGTCAGGG No data
1163228164_1163228168 -5 Left 1163228164 19:15979561-15979583 CCAGAGTGTAGGTCTCGTGTTCA No data
Right 1163228168 19:15979579-15979601 GTTCAGCCAGGGAGGCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228164 Original CRISPR TGAACACGAGACCTACACTC TGG (reversed) Intergenic