ID: 1163228166

View in Genome Browser
Species Human (GRCh38)
Location 19:15979568-15979590
Sequence GTAGGTCTCGTGTTCAGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228160_1163228166 3 Left 1163228160 19:15979542-15979564 CCTCCAAGAGAACCTGCTACCAG No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data
1163228161_1163228166 0 Left 1163228161 19:15979545-15979567 CCAAGAGAACCTGCTACCAGAGT No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data
1163228159_1163228166 13 Left 1163228159 19:15979532-15979554 CCATAGTTGGCCTCCAAGAGAAC No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data
1163228156_1163228166 28 Left 1163228156 19:15979517-15979539 CCCACTGGATAAACTCCATAGTT No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data
1163228163_1163228166 -9 Left 1163228163 19:15979554-15979576 CCTGCTACCAGAGTGTAGGTCTC No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data
1163228157_1163228166 27 Left 1163228157 19:15979518-15979540 CCACTGGATAAACTCCATAGTTG No data
Right 1163228166 19:15979568-15979590 GTAGGTCTCGTGTTCAGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228166 Original CRISPR GTAGGTCTCGTGTTCAGCCA GGG Intergenic