ID: 1163228293

View in Genome Browser
Species Human (GRCh38)
Location 19:15980173-15980195
Sequence TCAGCTCTGCTGTGTGACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228293_1163228301 24 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228301 19:15980220-15980242 CAGATCCCATGCCTTTGGGGTGG No data
1163228293_1163228298 20 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228298 19:15980216-15980238 GATCCAGATCCCATGCCTTTGGG No data
1163228293_1163228299 21 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data
1163228293_1163228297 19 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228297 19:15980215-15980237 TGATCCAGATCCCATGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228293 Original CRISPR TCAGCTCTGCTGTGTGACTT GGG (reversed) Intergenic