ID: 1163228294

View in Genome Browser
Species Human (GRCh38)
Location 19:15980174-15980196
Sequence CTCAGCTCTGCTGTGTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228294_1163228297 18 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228297 19:15980215-15980237 TGATCCAGATCCCATGCCTTTGG No data
1163228294_1163228298 19 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228298 19:15980216-15980238 GATCCAGATCCCATGCCTTTGGG No data
1163228294_1163228299 20 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data
1163228294_1163228301 23 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228301 19:15980220-15980242 CAGATCCCATGCCTTTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228294 Original CRISPR CTCAGCTCTGCTGTGTGACT TGG (reversed) Intergenic