ID: 1163228296

View in Genome Browser
Species Human (GRCh38)
Location 19:15980204-15980226
Sequence GGATCTGGATCAGATTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228296_1163228301 -7 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228301 19:15980220-15980242 CAGATCCCATGCCTTTGGGGTGG No data
1163228296_1163228308 29 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228308 19:15980256-15980278 CGGTCTGGCTTTGAATCTCAAGG No data
1163228296_1163228299 -10 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data
1163228296_1163228309 30 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228309 19:15980257-15980279 GGTCTGGCTTTGAATCTCAAGGG No data
1163228296_1163228305 9 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228305 19:15980236-15980258 GGGGTGGTGTTTGCATCCAGCGG No data
1163228296_1163228306 14 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228306 19:15980241-15980263 GGTGTTTGCATCCAGCGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228296 Original CRISPR GGATCTGGATCAGATTGCTT AGG (reversed) Intergenic