ID: 1163228297

View in Genome Browser
Species Human (GRCh38)
Location 19:15980215-15980237
Sequence TGATCCAGATCCCATGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228293_1163228297 19 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228297 19:15980215-15980237 TGATCCAGATCCCATGCCTTTGG No data
1163228294_1163228297 18 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228297 19:15980215-15980237 TGATCCAGATCCCATGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228297 Original CRISPR TGATCCAGATCCCATGCCTT TGG Intergenic
No off target data available for this crispr