ID: 1163228299

View in Genome Browser
Species Human (GRCh38)
Location 19:15980217-15980239
Sequence ATCCAGATCCCATGCCTTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163228293_1163228299 21 Left 1163228293 19:15980173-15980195 CCCAAGTCACACAGCAGAGCTGA No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data
1163228294_1163228299 20 Left 1163228294 19:15980174-15980196 CCAAGTCACACAGCAGAGCTGAG No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data
1163228296_1163228299 -10 Left 1163228296 19:15980204-15980226 CCTAAGCAATCTGATCCAGATCC No data
Right 1163228299 19:15980217-15980239 ATCCAGATCCCATGCCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163228299 Original CRISPR ATCCAGATCCCATGCCTTTG GGG Intergenic