ID: 1163228301 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 19:15980220-15980242 |
Sequence | CAGATCCCATGCCTTTGGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1163228296_1163228301 | -7 | Left | 1163228296 | 19:15980204-15980226 | CCTAAGCAATCTGATCCAGATCC | No data | ||
Right | 1163228301 | 19:15980220-15980242 | CAGATCCCATGCCTTTGGGGTGG | No data | ||||
1163228294_1163228301 | 23 | Left | 1163228294 | 19:15980174-15980196 | CCAAGTCACACAGCAGAGCTGAG | No data | ||
Right | 1163228301 | 19:15980220-15980242 | CAGATCCCATGCCTTTGGGGTGG | No data | ||||
1163228293_1163228301 | 24 | Left | 1163228293 | 19:15980173-15980195 | CCCAAGTCACACAGCAGAGCTGA | No data | ||
Right | 1163228301 | 19:15980220-15980242 | CAGATCCCATGCCTTTGGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1163228301 | Original CRISPR | CAGATCCCATGCCTTTGGGG TGG | Intergenic | ||