ID: 1163233061

View in Genome Browser
Species Human (GRCh38)
Location 19:16016704-16016726
Sequence CTGGGGATGCAGATGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163233061_1163233075 10 Left 1163233061 19:16016704-16016726 CCCTGCCCCATCTGCATCCCCAG No data
Right 1163233075 19:16016737-16016759 CATGGAAAGAGCAGAGGCTGAGG No data
1163233061_1163233076 21 Left 1163233061 19:16016704-16016726 CCCTGCCCCATCTGCATCCCCAG No data
Right 1163233076 19:16016748-16016770 CAGAGGCTGAGGAGCACCTATGG No data
1163233061_1163233077 22 Left 1163233061 19:16016704-16016726 CCCTGCCCCATCTGCATCCCCAG No data
Right 1163233077 19:16016749-16016771 AGAGGCTGAGGAGCACCTATGGG No data
1163233061_1163233072 4 Left 1163233061 19:16016704-16016726 CCCTGCCCCATCTGCATCCCCAG No data
Right 1163233072 19:16016731-16016753 ACCCAGCATGGAAAGAGCAGAGG No data
1163233061_1163233067 -8 Left 1163233061 19:16016704-16016726 CCCTGCCCCATCTGCATCCCCAG No data
Right 1163233067 19:16016719-16016741 ATCCCCAGGACCACCCAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163233061 Original CRISPR CTGGGGATGCAGATGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr