ID: 1163235043

View in Genome Browser
Species Human (GRCh38)
Location 19:16025064-16025086
Sequence GAGGACCTAATGGGCTCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163235032_1163235043 10 Left 1163235032 19:16025031-16025053 CCAAAGACCCGGGTCTGGGGGGC No data
Right 1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG No data
1163235024_1163235043 21 Left 1163235024 19:16025020-16025042 CCGCAGGGACTCCAAAGACCCGG No data
Right 1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG No data
1163235035_1163235043 2 Left 1163235035 19:16025039-16025061 CCGGGTCTGGGGGGCCCGGCCCT No data
Right 1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG No data
1163235034_1163235043 3 Left 1163235034 19:16025038-16025060 CCCGGGTCTGGGGGGCCCGGCCC No data
Right 1163235043 19:16025064-16025086 GAGGACCTAATGGGCTCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163235043 Original CRISPR GAGGACCTAATGGGCTCAGT TGG Intergenic
No off target data available for this crispr