ID: 1163241619

View in Genome Browser
Species Human (GRCh38)
Location 19:16067270-16067292
Sequence TGCCCGGGACACGCCCACGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163241611_1163241619 -8 Left 1163241611 19:16067255-16067277 CCCCACCCTAGGTCCTGCCCGGG 0: 1
1: 0
2: 2
3: 22
4: 233
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87
1163241609_1163241619 -7 Left 1163241609 19:16067254-16067276 CCCCCACCCTAGGTCCTGCCCGG 0: 1
1: 0
2: 0
3: 24
4: 242
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87
1163241613_1163241619 -9 Left 1163241613 19:16067256-16067278 CCCACCCTAGGTCCTGCCCGGGA 0: 1
1: 0
2: 0
3: 12
4: 120
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87
1163241614_1163241619 -10 Left 1163241614 19:16067257-16067279 CCACCCTAGGTCCTGCCCGGGAC 0: 1
1: 0
2: 0
3: 10
4: 124
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87
1163241608_1163241619 2 Left 1163241608 19:16067245-16067267 CCAGAGCAGCCCCCACCCTAGGT 0: 1
1: 0
2: 0
3: 25
4: 248
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87
1163241606_1163241619 3 Left 1163241606 19:16067244-16067266 CCCAGAGCAGCCCCCACCCTAGG 0: 1
1: 0
2: 2
3: 31
4: 324
Right 1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG 0: 1
1: 0
2: 0
3: 2
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163241619 Original CRISPR TGCCCGGGACACGCCCACGC GGG Intronic
900105223 1:978214-978236 TGCCCCGCACACGCCCGCCCCGG + Intronic
900415342 1:2532102-2532124 TGGCCTGGACACCCCCACACGGG - Intergenic
900537578 1:3186422-3186444 CGCCCGGGGCACCACCACGCAGG - Exonic
900616422 1:3567609-3567631 TGCCGGGGACACGGCCAGCCTGG + Intronic
902078038 1:13803009-13803031 TGCCCGTGACACGACCAGCCCGG - Intronic
903263470 1:22143231-22143253 GGCCCGGGACACCCCCCCGGGGG + Intronic
905442658 1:38005198-38005220 TGCCCGGGGCACGCCGAGCCCGG - Intronic
1067477979 10:46578866-46578888 CGCCCGGGACCCGCCCTGGCTGG + Intronic
1067616760 10:47762921-47762943 CGCCCGGGACCCGCCCTGGCTGG - Intergenic
1069158192 10:65054415-65054437 GGCCCAGGACGCGCCCGCGCTGG + Intergenic
1076909506 10:133379913-133379935 CTCCTGGGCCACGCCCACGCTGG - Intronic
1076911765 10:133394028-133394050 GGCCCGGGCCCCGCCCACTCCGG + Intronic
1077339906 11:2021624-2021646 GGCCTGGGCCACCCCCACGCTGG + Intergenic
1078559133 11:12355343-12355365 TGCCCTGGCCCTGCCCACGCTGG - Intronic
1202822891 11_KI270721v1_random:76813-76835 GGCCTGGGCCACCCCCACGCTGG + Intergenic
1102341449 12:112125370-112125392 TTCCAGGGACACGCCCCCGTGGG + Intergenic
1102874186 12:116436953-116436975 TGCCCAGCACCAGCCCACGCAGG - Intergenic
1103933567 12:124463465-124463487 TGCCCGGCCCCCACCCACGCAGG + Intronic
1104013721 12:124949179-124949201 TGCCTGGGACAGGGCCACACTGG + Intronic
1104927923 12:132323270-132323292 AGCCCAGCACACGCCGACGCTGG + Intronic
1113851578 13:113421251-113421273 CCCCAGGGACACGCCCACCCCGG + Intergenic
1113851598 13:113421301-113421323 CTCCCGGGACACGCCCACCCCGG + Intergenic
1113946766 13:114048793-114048815 CGCCCGGGACCCGCCGACACTGG + Intronic
1121667880 14:95686365-95686387 GGCCCGGGCCCCACCCACGCCGG + Intergenic
1122719040 14:103712047-103712069 TGGCCTGGACACGATCACGCTGG + Exonic
1128222991 15:65982001-65982023 TGCCCAGGCCTCACCCACGCAGG - Intronic
1128979438 15:72175766-72175788 TGTACGGGACACGCCCTTGCTGG - Intronic
1130296066 15:82647729-82647751 CGCCCGGGACTCGCCCGCACGGG + Intronic
1131890227 15:96964610-96964632 TGCCCAGGACACTGCCAGGCAGG - Intergenic
1132381539 15:101369858-101369880 TTCCCGGGACAGGCCCCTGCTGG + Intronic
1140780842 16:78295026-78295048 TGCCCAGGACAGGCTCACCCTGG + Intronic
1143023779 17:3929564-3929586 AGCCCGGGACAGGCCCTGGCAGG - Intronic
1144496472 17:15749327-15749349 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144606056 17:16666731-16666753 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1145908382 17:28528694-28528716 TGCCCAGCAAACGCCCAGGCTGG + Intronic
1148071361 17:44910693-44910715 TGCCTGGGACACCCCTAGGCTGG + Intronic
1150566948 17:66350318-66350340 TGCCCGGGGCTCACCCAGGCAGG + Intronic
1160168361 18:76532297-76532319 TGCCCAGGACCCACCCACCCAGG - Intergenic
1160420656 18:78741807-78741829 TTCCTGGGACACGCCCACGTGGG - Intergenic
1160679566 19:406548-406570 TGCCCGGGACGCCCCCTCCCAGG - Exonic
1160954451 19:1684120-1684142 TGCCCGGGATGCACCCACTCAGG - Intergenic
1162759750 19:12881575-12881597 TGCCCAGACCACGCCCACGACGG + Intergenic
1163241619 19:16067270-16067292 TGCCCGGGACACGCCCACGCGGG + Intronic
1164561546 19:29295731-29295753 TGCCCAGGACATGGCCACACGGG + Intergenic
1165448341 19:35868842-35868864 TGCCCTGGACATGTCCGCGCCGG - Intronic
1167386333 19:49166226-49166248 TGCCCGGGCCCCGCCCACAGAGG - Intronic
1167485975 19:49763175-49763197 GGCCGGGGACACCCCCACGGGGG - Exonic
1167648266 19:50717243-50717265 TTTCTGGGACACGGCCACGCTGG - Intronic
930177445 2:48314982-48315004 CGCCGGGGACACCCCCGCGCCGG - Intronic
936460924 2:112713364-112713386 TGCCTCCGCCACGCCCACGCTGG - Intergenic
937995992 2:127695552-127695574 GTCCCGGGACAGGCCCGCGCGGG + Intergenic
938071493 2:128310728-128310750 TGGCAGGTACACGCCCACACAGG - Intronic
938289474 2:130141793-130141815 TGGCGGGGACACGGCCAAGCAGG + Intronic
938467055 2:131531145-131531167 TGGCAGGGACACGGCCAAGCAGG - Intronic
947518680 2:230828273-230828295 CGCCCGGGAGACGCCCACCTCGG - Intergenic
1171449607 20:25226272-25226294 TGCCCGGCATCCGCCCATGCTGG - Exonic
1173364225 20:42370389-42370411 TGCCAGGGACATGTCCAGGCAGG - Intronic
1176194611 20:63831400-63831422 GCCCCGGGCCCCGCCCACGCCGG + Intergenic
1180066791 21:45416350-45416372 TGCCCCGGCCACCCCCACACCGG - Intronic
1183178098 22:36239021-36239043 TGGCCGGGCCACACCCAGGCTGG - Intronic
1184301959 22:43566738-43566760 TGCCAGGCACACTCCCATGCAGG + Intronic
1185253101 22:49815990-49816012 TGCCCGGGAGGCACCCACACAGG + Intronic
954751525 3:52816868-52816890 TGCCCGGGTAAGGCCCAGGCTGG - Exonic
972333279 4:38082724-38082746 TGCCCTGGGCTCGCCCACCCAGG + Intronic
972738243 4:41866089-41866111 ACCCCGGGACACTCCCACCCCGG + Intergenic
985998798 5:3613882-3613904 TGCGGGGGACACTCCCACACTGG + Intergenic
986288973 5:6383539-6383561 TCCCAGGGACACACCCACACGGG - Intergenic
994777190 5:104049691-104049713 TGCCCGGGACTCAGCCACACTGG + Intergenic
1002059945 5:176620260-176620282 CGCCCGGGACACGCTCACATGGG + Exonic
1002762029 6:209686-209708 CGCCCTGGCCTCGCCCACGCAGG - Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003926805 6:10884022-10884044 TGCCCGGGACTCGGCCAGGAGGG + Intronic
1004110444 6:12713037-12713059 TGCCCTGGAGACAGCCACGCTGG - Intergenic
1004169066 6:13281822-13281844 TTCCCGCGACAGGCCCACACTGG + Intronic
1006466228 6:34196442-34196464 TCCCAGGGTCAGGCCCACGCGGG + Intergenic
1012887292 6:104859978-104860000 CGCCCAGGCCACGCCAACGCGGG + Intergenic
1014851014 6:126340015-126340037 TTCCCGGGACCCGCCCACCGTGG + Intergenic
1019307300 7:341915-341937 TGCACGGGACCTGCCCACACAGG - Intergenic
1020085346 7:5307467-5307489 GGCCCGGCACAGGCCCACCCTGG - Exonic
1021144591 7:17069415-17069437 TGCCCTGCACACACCCACACAGG + Intergenic
1022954231 7:35366671-35366693 TGTCCGGGCCACGGCCACCCGGG + Intergenic
1025208975 7:57009821-57009843 GGCCCGGCACAGGCCCACCCTGG + Intergenic
1025662975 7:63567035-63567057 GGCCCGGCACAGGCCCACCCTGG - Intergenic
1026557450 7:71420748-71420770 TCCCAGGGACCTGCCCACGCTGG - Intronic
1036789542 8:11708812-11708834 GGCCCAGGACGCGCCCACGTCGG - Exonic
1039474590 8:37833079-37833101 TGCCCGGGGCACCCCCGCCCAGG - Exonic
1048360970 8:133696947-133696969 AGCCGGGGACACACCCATGCAGG + Intergenic
1061180310 9:129021606-129021628 TGCCCGGAGCACACCCAGGCAGG - Intronic
1062596230 9:137301125-137301147 GGCCCGGGACGCGCCGATGCCGG - Exonic
1201604538 Y:15770911-15770933 TGCCCGGAGCACACCCAGGCAGG + Intergenic