ID: 1163245397

View in Genome Browser
Species Human (GRCh38)
Location 19:16090564-16090586
Sequence ATGTTTAAGCAGAAGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 234}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163245397_1163245400 18 Left 1163245397 19:16090564-16090586 CCTTTGAGCTTCTGCTTAAACAT 0: 1
1: 0
2: 2
3: 28
4: 234
Right 1163245400 19:16090605-16090627 TCTGATTTCTCATCTAGGTTAGG 0: 1
1: 0
2: 0
3: 21
4: 203
1163245397_1163245399 13 Left 1163245397 19:16090564-16090586 CCTTTGAGCTTCTGCTTAAACAT 0: 1
1: 0
2: 2
3: 28
4: 234
Right 1163245399 19:16090600-16090622 CCTTCTCTGATTTCTCATCTAGG 0: 1
1: 0
2: 1
3: 50
4: 424

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163245397 Original CRISPR ATGTTTAAGCAGAAGCTCAA AGG (reversed) Intronic
900769796 1:4531575-4531597 ATGTTTTAGCTCAAGTTCAAAGG - Intergenic
903025870 1:20429575-20429597 ATATTTAAGCTGCAGCTGAAGGG - Intergenic
904498571 1:30901309-30901331 ATGTTTACGCAGGATCTCAGGGG - Intronic
904575650 1:31503544-31503566 AGGTTAGAGCCGAAGCTCAAGGG + Intergenic
905519243 1:38585471-38585493 ACTTTTCAGAAGAAGCTCAAAGG + Intergenic
907679252 1:56548347-56548369 GTGTTTAGGCAGAAGGTCAAAGG - Intronic
907930364 1:58993474-58993496 ATGTTTAAGCTGCATCTTAAAGG + Intergenic
908891229 1:68850377-68850399 ATGTTTAAGAAACAGCTCAGAGG - Intergenic
913208227 1:116561602-116561624 ATGTTTTAGCAGAATTTCATTGG + Intronic
915619602 1:157072929-157072951 ATTTTAAACCAGAATCTCAAAGG + Intergenic
916530360 1:165650871-165650893 ATATTTAAGCAGAAATTGAATGG + Intronic
916928215 1:169546249-169546271 ATTTTTAAGCAAGAGGTCAAAGG - Intronic
917608366 1:176659800-176659822 ATATTTAAGCAGCAGCTGATGGG - Intronic
919564301 1:199164654-199164676 ATGATAAAACTGAAGCTCAAAGG - Intergenic
920099023 1:203505378-203505400 ATGTTTAAGCTGAAACCCAAAGG + Intronic
920590511 1:207214239-207214261 ATTTTAAAGTAGTAGCTCAAGGG - Intergenic
920892369 1:210001736-210001758 ATGTTTAAGCAAAGACTCGAAGG + Intronic
921168230 1:212522891-212522913 GTGGTTCAGCAGCAGCTCAAAGG + Intergenic
921342965 1:214153007-214153029 ATGTTTAAACAGTTGCTCTAAGG + Intergenic
921766407 1:218977478-218977500 ATAATTAAAGAGAAGCTCAAAGG + Intergenic
921892366 1:220366252-220366274 ACATTTAAGCAGAGGCTTAAAGG + Intergenic
922065239 1:222131227-222131249 TTCTCCAAGCAGAAGCTCAAAGG - Intergenic
923218216 1:231869730-231869752 ATGTTTAAGGTGGAGCCCAATGG - Intronic
1063815989 10:9772367-9772389 ATGTTAAAGGAAAAGCTAAAGGG + Intergenic
1063832411 10:9969211-9969233 ATGATTAAGCATAAGGTAAATGG - Intergenic
1064889954 10:20159852-20159874 ATTTTTCAGCAGAAACTCGAAGG - Intronic
1066255212 10:33672131-33672153 ATGTTTAAAGAGAAGCTCTCAGG + Intergenic
1066396011 10:35022454-35022476 ATGTTTAAGCAGAAGTAACAGGG + Intronic
1068821940 10:61387643-61387665 ATGTTAAGGCAGAAGCTGTAAGG - Intergenic
1068855327 10:61791980-61792002 AAGTTTCAGCAGAAGTCCAAGGG + Intergenic
1069736497 10:70658796-70658818 AAGTTTAAGCCAATGCTCAATGG + Intergenic
1070664517 10:78333738-78333760 ATGGTTAAGCTGAGGCCCAAAGG + Intergenic
1071788644 10:88931476-88931498 GTGCTTAAGCAGAAGCTTAAAGG - Intronic
1071836037 10:89417879-89417901 ATGTACATGCAGAAGCTGAAGGG + Exonic
1072279805 10:93855459-93855481 GAGTTTTAGCAGAAACTCAAAGG - Intergenic
1076767005 10:132641559-132641581 GTCTTTCAGCAGAAGCTCCAGGG + Intronic
1078035092 11:7795271-7795293 AAGGTTAAGCAAAAGATCAATGG - Intergenic
1078763602 11:14272421-14272443 GTGTTTAAGCTGGAGCTCGATGG - Intergenic
1079439232 11:20493193-20493215 ATGTTTAAGCAAGTACTCAAAGG - Intronic
1079498355 11:21072244-21072266 ATTATTAAGCACAAGCGCAATGG + Intronic
1079500746 11:21098647-21098669 ATGTTGAAGCAGGTGCTCCAGGG + Intronic
1079888396 11:26017860-26017882 ATCTTGAAGCAGAACCTCACAGG - Intergenic
1079891752 11:26064342-26064364 ATCACTCAGCAGAAGCTCAAAGG - Intergenic
1080034260 11:27695869-27695891 AAGTTCAAGTAGAAGCTCTAGGG - Intronic
1080259937 11:30337958-30337980 ATATTTGAGCAGAACCTTAAAGG + Exonic
1080453028 11:32394289-32394311 ATAGATGAGCAGAAGCTCAAAGG - Intronic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1084703921 11:70804876-70804898 ATGGATGAGCAGGAGCTCAAGGG - Intronic
1085259712 11:75197481-75197503 CTGTTGGAGCAGAAGCACAAGGG + Intronic
1086201452 11:84208060-84208082 ATGTTGAAGCAGAAGCTTATAGG - Intronic
1087062076 11:93989012-93989034 ATGTTTAAGCAGAGGCCAAACGG + Intergenic
1087693658 11:101350865-101350887 ATATTAAAGCAGAGACTCAAAGG - Intergenic
1087933226 11:104002164-104002186 ATCTTTAAGCATAAGATCAAGGG - Intronic
1088609363 11:111562607-111562629 ATGAATAAGCTCAAGCTCAACGG - Intergenic
1089094647 11:115909467-115909489 ATGTTTTAGCAGCAGATCCACGG - Intergenic
1089173511 11:116532548-116532570 TTCTTTAAGCAGAAGCACCAAGG - Intergenic
1092035106 12:5327562-5327584 ATGTTTAACTAAAAGCTAAAAGG - Intergenic
1092365071 12:7871120-7871142 ATGTTTGGGGAGAAGCTGAATGG + Intronic
1092571478 12:9728085-9728107 ATTTATATGCAGAATCTCAAAGG - Intronic
1093556369 12:20479622-20479644 ATGTTTGACCATAAACTCAAAGG - Intronic
1093959941 12:25261365-25261387 ATGTATAAGAATAAGTTCAAAGG - Intergenic
1094863333 12:34496980-34497002 CTGTTTATGTAGAATCTCAAAGG - Intergenic
1095155783 12:38852001-38852023 ACATTTAAGCAGAGGCTTAAAGG - Intronic
1096449814 12:51728987-51729009 GTGTTTTGGCAGAAACTCAAAGG - Intronic
1098103345 12:67042444-67042466 TTTTTTCAGCAGAAGGTCAAAGG + Intergenic
1098626824 12:72682080-72682102 ATATTTAAGTAGAAACCCAAAGG + Intergenic
1099723723 12:86398203-86398225 ATGTTTTAGCAGAGGCTGTAGGG + Intronic
1099943195 12:89214568-89214590 ATGTCTAAGCAGAAGTTAAATGG + Intergenic
1100894737 12:99168636-99168658 ATATTTAAACAGAGACTCAAAGG + Intronic
1102036934 12:109776022-109776044 TGGTTAAAGCAGCAGCTCAATGG + Intergenic
1103731130 12:123028498-123028520 ACGTTTCAGCACAGGCTCAAGGG - Intronic
1106086671 13:26548839-26548861 ACATTTAAGTAGAACCTCAAAGG - Intergenic
1106733499 13:32566547-32566569 ATGTTGAAGGAGAAGCTTAGTGG - Intergenic
1108456413 13:50619241-50619263 ATGTTTAAACCGAACCTCCAAGG + Intronic
1109540569 13:63773761-63773783 ATGTATAAGCAGGAGCTCTTTGG - Intergenic
1110910809 13:80960368-80960390 TTTTTTAAGCTGAAACTCAAAGG - Intergenic
1111128289 13:83940970-83940992 AACTTAAAGCAGAAGCTGAAGGG - Intergenic
1111196875 13:84887034-84887056 AGATTTAAGCAGAAGATAAAGGG + Intergenic
1111281786 13:86035921-86035943 AGTTTTAAGCAGAAACTCTAGGG - Intergenic
1111545209 13:89724539-89724561 ATTTTTAAGCAAAAGCTAAATGG - Intergenic
1111812299 13:93106116-93106138 CTGTTTAAGCAGAGGTTGAAGGG + Intergenic
1113449706 13:110399094-110399116 ATGTTTAAGAAGCAGGTCAAAGG + Intronic
1115896210 14:38090595-38090617 ATGTCTAGGCAGAAGCTGCAGGG - Intergenic
1115974660 14:38983141-38983163 ATGTTTAAGCATCACCTGAATGG - Intergenic
1116050962 14:39802560-39802582 AAGTCTAAACAGAAGCTAAAGGG - Intergenic
1117541704 14:56753139-56753161 GCCTTTAAGCAAAAGCTCAATGG + Intergenic
1118511811 14:66483415-66483437 ATAGATAAGCAGAAGTTCAAGGG - Intergenic
1118884443 14:69854603-69854625 ATATTTGAGCAGAGGCTTAAAGG - Intronic
1120414625 14:84203904-84203926 ATGTTTTAGGAAAACCTCAAAGG + Intergenic
1123752412 15:23367591-23367613 ATATTTAAGAAAAAGCTAAAAGG + Intergenic
1124179644 15:27460616-27460638 ATCTTGAAGCAGAAGCTTACAGG + Intronic
1125881324 15:43198675-43198697 ATGTTAAACCTGAAGATCAAGGG + Intronic
1133719086 16:8477673-8477695 ATATTTAGGCAGAAGCTAGATGG + Intergenic
1135783908 16:25330767-25330789 ATTTCTAAGCAGAAGCTTTAAGG + Intergenic
1135883043 16:26277957-26277979 ATGTTTATGCAAAAGATAAATGG - Intergenic
1136455238 16:30376506-30376528 ATGTTCGGGGAGAAGCTCAAGGG + Exonic
1136507211 16:30712340-30712362 ATGTATGAGAAGAAGCTTAATGG + Exonic
1139444923 16:66991742-66991764 ATGTGGAAGCTGAAGCTCAAAGG - Intronic
1141663977 16:85456362-85456384 ATGTTCCAGAACAAGCTCAAAGG - Intergenic
1142720095 17:1770190-1770212 CTGTGTAAGCAGGAGCTCAGGGG + Intronic
1146626827 17:34441445-34441467 GTGTCTAAGCTGAACCTCAAGGG - Intergenic
1146925979 17:36745781-36745803 CCGTTTAAGCAGAAGCCCAGAGG + Intergenic
1148319871 17:46741558-46741580 ATGTTTAAGCTGAATACCAAAGG - Intronic
1148686722 17:49505244-49505266 ATGTGGAAGCAGAAGCAGAAAGG - Intronic
1150833671 17:68544845-68544867 ATGTTTTAGAAGAACCTAAAAGG - Intronic
1151258940 17:72901688-72901710 GTGTTTATGCAAAAGCTTAATGG - Intronic
1154075030 18:11192186-11192208 ATGTTTAAGAAGCAGCTACATGG + Intergenic
1155041506 18:22069118-22069140 ATGTGTAAGCAGAAGCTGTAGGG - Intergenic
1155615266 18:27714784-27714806 GTGTTTTGGCAGAAACTCAAAGG - Intergenic
1157470943 18:47988219-47988241 ATGTTGAAGCTAAAGTTCAAAGG + Intergenic
1158731232 18:60024994-60025016 ATCTTTAAGCAAAGACTCAAAGG + Intergenic
1158733030 18:60046710-60046732 ATGTTAAAGCAAAAAATCAATGG - Intergenic
1158784386 18:60691943-60691965 ATATATAAGGAGAAGCTCATTGG + Intergenic
1159083211 18:63758923-63758945 ATGTTTAAGAAGAAATTTAAAGG + Intronic
1162317507 19:9948642-9948664 ATGTTTAAACAGAAACAAAATGG + Intergenic
1163245397 19:16090564-16090586 ATGTTTAAGCAGAAGCTCAAAGG - Intronic
1164306487 19:24008247-24008269 ATTTTTAAACAGTAGCTCAGAGG - Intergenic
1165077541 19:33288594-33288616 ATGTTGATGCAGAACTTCAAAGG + Intergenic
1167714945 19:51137227-51137249 ATGTCCAAGAAGAGGCTCAAGGG - Intergenic
927615005 2:24584719-24584741 AGCTTTAAGCAGACTCTCAAAGG - Intronic
928516977 2:32053064-32053086 ATTTTTAAGCAAAGCCTCAAAGG + Intergenic
928990699 2:37230822-37230844 ATGTTTGAGCAGAATCCTAAAGG - Intronic
929131496 2:38578692-38578714 TTGGGTAAGCAGAAGCTAAATGG - Intronic
931186972 2:59962491-59962513 ATTATTAAGCAGAAGTTCTATGG - Intergenic
932119625 2:69086621-69086643 ATGATTAAGCAGAAGGCCAGGGG + Intronic
932672065 2:73746444-73746466 ACCTGTCAGCAGAAGCTCAAGGG + Intergenic
934076337 2:88431812-88431834 ATGTTTAACTAGAAGTTAAATGG + Intergenic
935283977 2:101547143-101547165 ATGTTTCTGCAGAAGCAGAATGG - Intergenic
937763301 2:125631271-125631293 TTGTTTCAGCAGGGGCTCAAGGG + Intergenic
937824557 2:126353579-126353601 ATTTTTAAAAAGAAGATCAAAGG + Intergenic
938228044 2:129634851-129634873 ATATCTGAGCAGAAGCTCTAAGG - Intergenic
943263405 2:185695505-185695527 ATGTTTAAGCATTAGTGCAAAGG - Intergenic
943556924 2:189416933-189416955 ATGTTTAAGCAGATGACAAAGGG - Intergenic
945158978 2:206869247-206869269 GTTTTTAAGCAGAATCTCATGGG + Intergenic
945499658 2:210555777-210555799 ATGTTTAACCAGGCTCTCAAGGG - Intronic
946979787 2:225197628-225197650 AAATATAAGCAGAAGCTAAATGG - Intergenic
947446225 2:230164706-230164728 ATTTTTAAACAAAAGTTCAAAGG - Intergenic
947464132 2:230326297-230326319 ATGTTGAATCAGAATCTAAATGG + Intergenic
1168867106 20:1096247-1096269 GTGTTACAGCAGGAGCTCAAGGG - Intergenic
1169667816 20:8057958-8057980 ACTTTTAAGCAGAGGCTTAAAGG + Intergenic
1170582440 20:17709635-17709657 ATGATTGCCCAGAAGCTCAATGG + Intronic
1171088613 20:22262887-22262909 ATGTGAAAGCTGAAGCTCAGAGG - Intergenic
1171222430 20:23411392-23411414 ATGCTTTACCAGAAACTCAAGGG + Intronic
1172657887 20:36548112-36548134 ATGTTTGGGGAGAAGCTGAACGG + Exonic
1172706254 20:36884292-36884314 ATGTTTAAGGACCAGCTCAGAGG - Intronic
1175505091 20:59477061-59477083 AAGCTTAATCAGAAACTCAAAGG + Intergenic
1176849432 21:13901387-13901409 AAGTTCAAGCAGAAGGTTAATGG - Intergenic
1177603968 21:23355161-23355183 ATATTGAAGCAGAAGCTTACAGG + Intergenic
1181913076 22:26255987-26256009 ATGGTTAAGCTGAAGTTCAAAGG + Intronic
1182269060 22:29142047-29142069 ATCTTTAAGAAGAAACTCAAGGG + Exonic
1182805676 22:33068235-33068257 ATCTTTATGCACAATCTCAAGGG - Intergenic
1183009845 22:34935861-34935883 ATGTTTATGATGAGGCTCAAGGG - Intergenic
949402368 3:3679099-3679121 AAGATTGAGCAGAAGTTCAAAGG - Intergenic
950110817 3:10417450-10417472 ATGTTTACACAGAAGCTGGACGG + Intronic
950213491 3:11140961-11140983 TTGATTAAGCAGGTGCTCAAGGG + Intronic
951610691 3:24489887-24489909 ATTTTAAATCAGAAGCTCACCGG + Intronic
954530645 3:51315817-51315839 ATCTTCAAGCAGAAGCTCCCAGG + Intronic
954543889 3:51416330-51416352 ATGTTTAAGCAGAGCCTTGAAGG - Intronic
955782684 3:62502765-62502787 ATGTTATATCAGAGGCTCAAAGG - Intronic
956015241 3:64875439-64875461 ATAGTTAAGCTGAAACTCAAAGG + Intergenic
956859540 3:73308760-73308782 ATTTTTAAACAGAAGCTCCAGGG + Intergenic
958008287 3:87841973-87841995 AAGTCTAAGCAGAAGCTCTTGGG - Intergenic
959575652 3:107930174-107930196 ATGTATAAGCAGAAGCTCAGGGG + Intergenic
960051434 3:113242441-113242463 GTGTTTTAGCAGAAGCTCTGTGG + Intronic
961807582 3:129500414-129500436 ATGATGAAACAGAAGCTAAAGGG + Intronic
963775062 3:149430417-149430439 ATGTTTAAACAGAAGCCAGATGG - Intergenic
966558997 3:181297814-181297836 ATATTTGAGCAGGATCTCAAAGG - Intergenic
966657298 3:182373929-182373951 ATGTTCAAGAAGAAGCTGATTGG - Intergenic
967395396 3:189002880-189002902 TTTTTTAAGCACATGCTCAATGG + Intronic
967830303 3:193912875-193912897 AAGTCTGAGCAGAGGCTCAAAGG - Intergenic
968043088 3:195604335-195604357 ATGTTTTAAAAGGAGCTCAATGG + Intergenic
970548124 4:17150280-17150302 ATGTTTAAGCAGCTTCTGAAGGG + Intergenic
970639945 4:18052673-18052695 AAGTTCAAGGAGAAGCTAAAGGG + Intergenic
970897726 4:21122895-21122917 ATTTTTAACCAGTAGCTTAAAGG - Intronic
971416098 4:26431501-26431523 ATTTTAGAGCAAAAGCTCAAAGG - Exonic
971605034 4:28648072-28648094 TTGTTTAAGAATAAGGTCAAAGG - Intergenic
971718575 4:30214670-30214692 ATGTTAAAACAGAAGCTTTAGGG - Intergenic
974050058 4:56932121-56932143 ATCTTGAAGAAGCAGCTCAAGGG + Exonic
974229104 4:59086523-59086545 ATGTCTCAGCAGTAGCTGAAAGG + Intergenic
974601833 4:64093221-64093243 AAGTTTAAGAAAATGCTCAAGGG + Intergenic
974890632 4:67878160-67878182 TTGTTTAAGCAGAAACTTAAAGG - Intronic
976508882 4:85883891-85883913 ATGTTTAAGGAAAAGCACACTGG + Intronic
976695103 4:87910669-87910691 ATGTTTAAGCTGCATCTGAAAGG - Intergenic
977449857 4:97181100-97181122 CTGATTAAGAAGAAGCTGAATGG - Intergenic
977836014 4:101647227-101647249 ATGTTATAGCAGAAGCTCAGTGG + Intronic
981107595 4:140898727-140898749 AAGTTTAAGCATGAACTCAATGG - Intronic
982159126 4:152549958-152549980 ATGTCTAAACTGAATCTCAAGGG - Intergenic
983953683 4:173672786-173672808 ACATTTAAGCAGAGACTCAAAGG + Intergenic
984622873 4:181973832-181973854 ATGTTTAAGCAAAGGCTTGAAGG + Intergenic
984795010 4:183652048-183652070 ATGTTTAAGCAAAAACCAAAGGG - Intronic
986019904 5:3791305-3791327 ATGTTTCATCAGATCCTCAAAGG - Intergenic
987016416 5:13824627-13824649 TTGATTAAGAATAAGCTCAAAGG - Intronic
988435534 5:31170190-31170212 TTGTTTAAGGAGAAGTTAAAAGG - Intergenic
988978243 5:36537120-36537142 ATGTTTAAGCTGAAGAGGAATGG + Intergenic
989766295 5:45088406-45088428 ATGTACAAACAGAAGCTCAAGGG - Intergenic
990529041 5:56655639-56655661 ATGGTTAACCAGAAGCTCACGGG - Intergenic
990995774 5:61730933-61730955 GTGTTTAAGCAGAGGCACCATGG - Intronic
992210379 5:74473846-74473868 ATGTTACAGAAGCAGCTCAAAGG + Intergenic
994044106 5:95288913-95288935 ATATTTGAGCAGAAACCCAAAGG + Intergenic
994225515 5:97247970-97247992 ATGTTTGAGCAGGAGAACAATGG + Intergenic
994267116 5:97730666-97730688 ATGTATAAACAGAGGCTCAGAGG + Intergenic
995004346 5:107172671-107172693 ATACTTAAGCAGTATCTCAAAGG - Intergenic
996124742 5:119711068-119711090 ATGTATAAGCAGAAGTCCACTGG - Intergenic
996195385 5:120599997-120600019 ATTTTTAAACAGAAACTTAAAGG - Intronic
999186010 5:149709529-149709551 ATTTTTAGGCAGGAGCACAATGG + Intergenic
1000414169 5:160966033-160966055 AAATTTAAGCAGAAACTCAAAGG + Intergenic
1001404170 5:171463868-171463890 ATATTTAAGCAGAAGCTGTAGGG - Intergenic
1004528041 6:16427610-16427632 AAGTTTGAGCAGAACATCAAGGG + Intronic
1007408317 6:41647391-41647413 ATGTTTCGGCAGAAGGGCAAGGG + Intronic
1008071959 6:47106964-47106986 ATGCTTAAGCTAAATCTCAAAGG - Intergenic
1009531442 6:64821763-64821785 ATGTTAAAGCATAACTTCAAGGG + Intronic
1009868165 6:69423722-69423744 ATGTTGAAGCCTAATCTCAAAGG - Intergenic
1011162731 6:84410076-84410098 ATGTTGAAGCAGGGGTTCAAAGG + Intergenic
1011468712 6:87686438-87686460 AAGTTTAAGGAGAACCACAAAGG + Intronic
1013083386 6:106832643-106832665 ATCTTGAAGCAAAAACTCAAAGG + Intergenic
1013338506 6:109190380-109190402 ATGTTTATTCATAAGCTAAAAGG + Intergenic
1013387267 6:109643897-109643919 ATGTTTAAATAGAAACTTAAAGG - Intronic
1015411289 6:132896702-132896724 ATATTTCATCACAAGCTCAAAGG + Intergenic
1016400165 6:143671434-143671456 ATGTTTAAGCAAAAACACAAAGG - Intronic
1018017179 6:159723110-159723132 ATGTTTTAGCAGAGGTTCAAAGG - Intronic
1022103070 7:27180603-27180625 ATTTTAAGGCAGAAGTTCAAAGG + Intergenic
1029610061 7:101622095-101622117 ATGTTTGGGGAGAAGCTGAAGGG - Exonic
1030354039 7:108523589-108523611 ACCTTAAAGCAGAAGCTGAAGGG - Intronic
1033005447 7:137557033-137557055 ATGTTTAAGCTCAAGTCCAAAGG - Intronic
1033399423 7:141007732-141007754 AGGTTTAAGCAGAGGCTTGAAGG - Intronic
1033799878 7:144888083-144888105 AGGTTTAAGCTGAGTCTCAAAGG - Intergenic
1034101503 7:148454595-148454617 ATTTTAAAGCAGAAGCTAACAGG + Intergenic
1034547873 7:151800852-151800874 AGGTATCAACAGAAGCTCAATGG + Intronic
1034834345 7:154337807-154337829 ACGTTTAAGCACCAGCTCTAAGG + Intronic
1036283575 8:7422733-7422755 ATCTTTGTGCAGAAGCTCCAAGG - Intergenic
1036337894 8:7888788-7888810 ATCTTTGTGCAGAAGCTCCAAGG + Intergenic
1036488611 8:9202623-9202645 ATCTTGAAGCAGGAGCTCACAGG - Intergenic
1038867686 8:31457399-31457421 ATGTTTAAGCAAAAAGTCTATGG - Intergenic
1040319548 8:46285745-46285767 ATGGGTGAGCAGAAGATCAATGG - Intergenic
1043724253 8:83589673-83589695 AGGTTTTAGGAGGAGCTCAATGG - Intergenic
1044257897 8:90087251-90087273 ATGTAGAAGTAGAAGCTGAATGG + Intronic
1045930856 8:107624706-107624728 ATGTTTAAGCTGAAACTGGAAGG - Intergenic
1048921007 8:139230109-139230131 ACGTGTAAGCAGAATCTCAAAGG - Intergenic
1049188611 8:141273139-141273161 ATGTTCTAACAGAAGCTCAGTGG - Intronic
1050132849 9:2430651-2430673 AGGTTTAGGCAGAATCTCATGGG - Intergenic
1050290042 9:4144513-4144535 ATGATTAAGCATGAGCTCATTGG + Intronic
1051227438 9:14916119-14916141 ATGTTGAAGATGAAGCTCACAGG + Intergenic
1052527903 9:29644249-29644271 ATGTTTAAGCTGAATCTATAAGG + Intergenic
1053420229 9:37972652-37972674 ATGTTTAAGCTGGGCCTCAAAGG + Intronic
1053613420 9:39739230-39739252 ATTTTAAAGCAAAAGCTCAAAGG + Intergenic
1053871462 9:42497187-42497209 ATTTTAAAGCAAAAGCTCAAAGG + Intergenic
1054240095 9:62603171-62603193 ATTTTAAAGCAAAAGCTCAAAGG - Intergenic
1054554228 9:66637697-66637719 ATTTTAAAGCAAAAGCTCAAAGG - Intergenic
1056022464 9:82454512-82454534 ATGTTTAAGCAATAAGTCAATGG + Intergenic
1058361779 9:104155814-104155836 CAGATTAAGCAGAAGGTCAAAGG - Intergenic
1059896562 9:118872804-118872826 ATCTTTGAGCAGAGGCCCAAAGG - Intergenic
1061221553 9:129254997-129255019 ATATTTAAGCAGAATCTTATAGG + Intergenic
1062059850 9:134489312-134489334 ATGTTTTAGCAGAGGCTCAAAGG + Intergenic
1187021624 X:15388449-15388471 ATGAAGAAGCAGAAGGTCAAAGG - Intronic
1189363949 X:40373909-40373931 ATGTTTCAGATGAAGCCCAAAGG - Intergenic
1191024980 X:55904652-55904674 AAGTTTAAGGAGAAGCCCTAAGG + Intergenic
1191717124 X:64201397-64201419 ATCGTTAAGCAGAAGAGCAATGG + Intronic
1191882827 X:65859679-65859701 ACATTTGAGCAGAACCTCAAAGG - Intergenic
1192365870 X:70472605-70472627 ATGTTTGAGCAGAGGCTGAAGGG + Intronic
1192410983 X:70931860-70931882 ATGTGTAAGCTGAGGCTCAGAGG + Intergenic
1193422445 X:81298080-81298102 TTGTTTTAGCAAAAACTCAAGGG - Exonic
1196109388 X:111929995-111930017 ATGTTTGAGCAGAGGCAGAATGG - Intronic
1196703215 X:118694101-118694123 AAGTTGAAGCAGAAGACCAAAGG - Intergenic
1197417903 X:126197744-126197766 ATGATGAAACTGAAGCTCAAAGG - Intergenic
1199395501 X:147332729-147332751 ATGTTCAACCAAAAACTCAAGGG - Intergenic