ID: 1163247955

View in Genome Browser
Species Human (GRCh38)
Location 19:16109002-16109024
Sequence AAACTGCGGCCTGGGAAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163247946_1163247955 25 Left 1163247946 19:16108954-16108976 CCTAGAACAGACTGGACCATCTC No data
Right 1163247955 19:16109002-16109024 AAACTGCGGCCTGGGAAGCTTGG No data
1163247949_1163247955 9 Left 1163247949 19:16108970-16108992 CCATCTCTAAGAAGCAGGGAGCC No data
Right 1163247955 19:16109002-16109024 AAACTGCGGCCTGGGAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163247955 Original CRISPR AAACTGCGGCCTGGGAAGCT TGG Intergenic
No off target data available for this crispr