ID: 1163248405

View in Genome Browser
Species Human (GRCh38)
Location 19:16111491-16111513
Sequence CTCGCGCGCCGGCAGCCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 112}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163248405_1163248414 17 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248414 19:16111531-16111553 TGCCTTCCCTCTCCTACAGTGGG 0: 1
1: 0
2: 2
3: 20
4: 217
1163248405_1163248413 16 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248413 19:16111530-16111552 CTGCCTTCCCTCTCCTACAGTGG 0: 1
1: 0
2: 1
3: 46
4: 300
1163248405_1163248420 23 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248420 19:16111537-16111559 CCCTCTCCTACAGTGGGGCGGGG 0: 1
1: 0
2: 1
3: 7
4: 137
1163248405_1163248422 27 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248422 19:16111541-16111563 CTCCTACAGTGGGGCGGGGCCGG 0: 1
1: 1
2: 1
3: 30
4: 217
1163248405_1163248417 21 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248417 19:16111535-16111557 TTCCCTCTCCTACAGTGGGGCGG 0: 1
1: 0
2: 0
3: 14
4: 186
1163248405_1163248415 18 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248415 19:16111532-16111554 GCCTTCCCTCTCCTACAGTGGGG 0: 1
1: 0
2: 0
3: 16
4: 184
1163248405_1163248418 22 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248418 19:16111536-16111558 TCCCTCTCCTACAGTGGGGCGGG 0: 1
1: 0
2: 0
3: 22
4: 199
1163248405_1163248423 28 Left 1163248405 19:16111491-16111513 CCGCCAGGCTGCCGGCGCGCGAG 0: 1
1: 0
2: 1
3: 7
4: 112
Right 1163248423 19:16111542-16111564 TCCTACAGTGGGGCGGGGCCGGG 0: 1
1: 0
2: 3
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163248405 Original CRISPR CTCGCGCGCCGGCAGCCTGG CGG (reversed) Intergenic