ID: 1163250103

View in Genome Browser
Species Human (GRCh38)
Location 19:16121744-16121766
Sequence GTTTAGGGACACAGCCGGTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 56}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163250097_1163250103 9 Left 1163250097 19:16121712-16121734 CCTTTAATGTTGCTAATATCCCT 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 56
1163250096_1163250103 30 Left 1163250096 19:16121691-16121713 CCTACTGAGGACAGTTATTTTCC 0: 1
1: 0
2: 1
3: 6
4: 176
Right 1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 56
1163250100_1163250103 -10 Left 1163250100 19:16121731-16121753 CCCTTCTCTTCATGTTTAGGGAC 0: 1
1: 0
2: 1
3: 13
4: 236
Right 1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG 0: 1
1: 0
2: 1
3: 5
4: 56

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163250103 Original CRISPR GTTTAGGGACACAGCCGGTC AGG Exonic
904951225 1:34240604-34240626 GTTTGGGGACACAGGCAGTGCGG - Intergenic
915125801 1:153663226-153663248 GTTTAGGGCCAAAGGCTGTCTGG + Exonic
916852605 1:168718929-168718951 TTTTAGGGAAACAGCAGCTCAGG - Intronic
918182930 1:182100811-182100833 GGTGAGGGACACAGCCTCTCTGG + Intergenic
1076027823 10:127130923-127130945 GCTTAGGGAGACAGCTGTTCAGG + Intronic
1077170909 11:1165324-1165346 ACACAGGGACACAGCCGGTCTGG - Exonic
1083939597 11:65888545-65888567 CTTCCGGGACACAGCCAGTCGGG + Intergenic
1085275041 11:75292983-75293005 GTTTAGGAAAACAGCCGGGTTGG - Intronic
1091442940 12:525740-525762 GTTTAGGGCCACAGTGGGACAGG - Intronic
1096520621 12:52182668-52182690 GTTGAGGGAGACAGCTGGCCTGG + Intronic
1101150465 12:101878078-101878100 GTTTAGGGAGGCAGCGGGTGCGG + Intronic
1101331321 12:103760160-103760182 TTTTAGGGAGACAGCAGGTCAGG + Intronic
1118466755 14:66038255-66038277 GATTAGGGACAGAGGAGGTCAGG - Intergenic
1118908227 14:70038916-70038938 GTTTAGGGACACTGAAGCTCAGG + Intergenic
1124625023 15:31302823-31302845 GCTGAGGGACACAGCAGGACAGG + Intergenic
1127065231 15:55230405-55230427 GTTATGGGACACAGCAGGGCAGG - Exonic
1127890848 15:63249639-63249661 TTTTAGGGACACAGCGGGTCAGG + Exonic
1132241997 15:100265368-100265390 GTTTAGGGAGACACCTGGTTGGG + Intronic
1132878721 16:2151694-2151716 GATGTGGGACACAGCTGGTCAGG + Exonic
1147552522 17:41454183-41454205 GTTTCTGGCCACAGCCTGTCTGG + Intergenic
1148328226 17:46796461-46796483 AATTAGGGACACATCTGGTCTGG + Intronic
1151190128 17:72392337-72392359 GACTCGGGACACAGCAGGTCAGG - Intergenic
1152099434 17:78292391-78292413 CCTGAGGGACACAGCCGGACTGG - Intergenic
1152744547 17:82032765-82032787 GCTGTGGGACACAGCGGGTCAGG + Exonic
1153797031 18:8633183-8633205 TCTTAGGGACACAGCAGGTCAGG + Exonic
1154962829 18:21327355-21327377 GTTTAGTGACCCAACAGGTCTGG - Intronic
1155032566 18:21997182-21997204 CTTGAGGGAGACAGCAGGTCAGG - Intergenic
1160534752 18:79585918-79585940 GTGTAGGGGCACAGCGGGTGTGG - Intergenic
1163250103 19:16121744-16121766 GTTTAGGGACACAGCCGGTCAGG + Exonic
1167261544 19:48461767-48461789 GATTCGGGAGACAGCCGGGCGGG + Exonic
926181783 2:10651151-10651173 GTTTAGGCACACAGCCTGCGGGG + Intronic
936474888 2:112831446-112831468 GGTTAGGGACACAGCAGTGCAGG + Intronic
948688860 2:239689597-239689619 GTTTAAGGATACAGCTGTTCAGG + Intergenic
1180249551 21:46572669-46572691 GTTGAGGGCCACATCAGGTCAGG - Intergenic
1181417988 22:22773953-22773975 GTTATGGGACAGAGCTGGTCAGG + Intronic
1183178256 22:36239870-36239892 GTTTAAGGGCACAGCAGGTGGGG + Exonic
1183385474 22:37511685-37511707 GTTGAGGGACTCATCCAGTCCGG + Intronic
952707380 3:36392956-36392978 GTTTAAGGACTCAGGAGGTCAGG - Intronic
954968235 3:54629647-54629669 TTTTAGTGACACAGCCGGCGAGG + Intronic
962252021 3:133841357-133841379 GCTCTGGGACACAGCTGGTCAGG - Exonic
965699249 3:171442709-171442731 GTTTAGGTACCCAGCTGGTCAGG + Intronic
987814311 5:22880731-22880753 GTTTAGCAACACAGTCGGGCAGG - Intergenic
994854522 5:105099650-105099672 GAATTGGGACACAGCAGGTCAGG + Intergenic
1000051037 5:157563143-157563165 GTCTAGGGACGCAGCTGGCCAGG + Intronic
1000997668 5:167974805-167974827 GTTCAGGGTCACAGTCGGTCAGG - Intronic
1001084617 5:168691665-168691687 GTTTTGGGAAACAGGCAGTCCGG - Intronic
1008453103 6:51675687-51675709 GATAAGTGACACAGCCTGTCAGG + Intronic
1008955156 6:57207664-57207686 GTTATGGGACACTGCAGGTCAGG - Exonic
1014686867 6:124512638-124512660 ATTTAGAGCCACAGCCTGTCTGG + Intronic
1018375568 6:163208015-163208037 GTTTGGGGCCACAGACGGTCGGG + Intronic
1023793236 7:43770381-43770403 GTAAAGGCACACAGACGGTCAGG - Intronic
1028726403 7:94092568-94092590 GGGTAGGGACACAGCGAGTCAGG - Intergenic
1033049725 7:137993280-137993302 GTTGAGGGACACAGGCTCTCTGG - Intronic
1035547718 8:496575-496597 GTGTTGGGACACAGCAGGCCTGG - Intronic
1038416335 8:27398756-27398778 GTTTAGGGACACTGGCTTTCAGG - Intronic
1038500522 8:28039875-28039897 GTTTGGAGACACAGCTGGTAAGG + Intronic
1052597209 9:30575427-30575449 GATTAGTGTCACAGCAGGTCTGG - Intergenic
1057739113 9:97696818-97696840 GTTTAGGGATGCAGCCGCCCCGG - Intronic
1060804188 9:126564413-126564435 GCCTGGGGACACAGCAGGTCAGG - Intergenic
1185877483 X:3712858-3712880 GGTTAGGCACCCGGCCGGTCGGG + Intronic
1186864797 X:13708923-13708945 GATTTGGGACACGGCAGGTCAGG + Exonic
1197784164 X:130184290-130184312 GGTGTGGGACACAGCAGGTCAGG + Exonic
1198394000 X:136205270-136205292 GTCTAGGGCCACAGCCGGGGAGG + Intronic