ID: 1163250120

View in Genome Browser
Species Human (GRCh38)
Location 19:16121883-16121905
Sequence CCGAAGCCTAGATGTTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163250120 Original CRISPR CCGAAGCCTAGATGTTTCTG TGG Intronic
900862772 1:5245029-5245051 CCTCAGCCCAGAGGTTTCTGCGG - Intergenic
901143234 1:7049263-7049285 CAGAAGCCAAGATGTTCCTTAGG + Intronic
910542567 1:88377407-88377429 CTGTATCCTAGATGTCTCTGGGG + Intergenic
922098866 1:222465601-222465623 CCGAATGCTAGCCGTTTCTGTGG + Intergenic
1062786781 10:271511-271533 CTGGAGCCTAGGTGTTGCTGGGG + Intergenic
1067748445 10:48954248-48954270 GCCAAGCCTAGAGGATTCTGAGG - Intronic
1069715889 10:70521068-70521090 CTGCAGCCTGGATGATTCTGTGG + Intronic
1072429548 10:95358779-95358801 CAGAAGCCTATGTGGTTCTGCGG - Intronic
1083347419 11:62003290-62003312 CTTCAGCCGAGATGTTTCTGGGG + Intergenic
1087200395 11:95338958-95338980 CCGGAGCCAAGAACTTTCTGAGG + Intergenic
1088416348 11:109593435-109593457 CTGAAGCAAAGATGTTTATGAGG + Intergenic
1091207879 11:133833437-133833459 CCGACGCCCAGAGGCTTCTGCGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1091841577 12:3625200-3625222 CGGAAGCCTTGGTGTGTCTGTGG - Intronic
1093789218 12:23228342-23228364 CCGAAGTCTAGATTTTACTTTGG - Intergenic
1096476707 12:51913224-51913246 CCGCAGCCCCGATGTTCCTGGGG - Exonic
1098511299 12:71316961-71316983 CCGATGCCAAGATGATGCTGAGG - Intronic
1099084475 12:78228071-78228093 CTGCAGCCAAGATGTTTGTGTGG - Intergenic
1099768852 12:87026466-87026488 CAGAAACATAGATGTATCTGGGG + Intergenic
1099952122 12:89315424-89315446 CTGAAGCCTAGATGTTTGACAGG + Intergenic
1104380731 12:128305495-128305517 CCGAACTTTAGATGATTCTGCGG + Intronic
1105613247 13:21987658-21987680 GCGCAGCCTAGACATTTCTGAGG - Intergenic
1111270156 13:85871237-85871259 CAGAAGCCTAGAAGTCTATGTGG - Intergenic
1111498506 13:89086396-89086418 CTGGAGCCTAGATGTTTGTTTGG - Intergenic
1127790343 15:62392733-62392755 CCCAACCCCAGAGGTTTCTGTGG - Intronic
1131365652 15:91837165-91837187 CCCACCCCTAGATGTTACTGTGG - Intergenic
1142903685 17:3028529-3028551 CTGAAGCCAAAATGTTCCTGGGG + Intronic
1151146633 17:72047320-72047342 CCGAGGCCTTGATGCTTCTGCGG - Intergenic
1158404756 18:57151311-57151333 CCCAAGCCTAGAAGTGCCTGGGG - Intergenic
1163250120 19:16121883-16121905 CCGAAGCCTAGATGTTTCTGTGG + Intronic
1163884389 19:19952951-19952973 CCGAAGCATAGATGGGCCTGTGG - Intergenic
926012847 2:9422680-9422702 CTGAAGCCGAGAACTTTCTGGGG + Exonic
929781321 2:44959024-44959046 CAGGAGCCCAGATGTTCCTGGGG - Intergenic
930520434 2:52458821-52458843 TCTAAGCCTAGAGATTTCTGGGG - Intergenic
932752782 2:74382081-74382103 TGGAAGCCTAGATATGTCTGTGG - Intronic
944022673 2:195125496-195125518 CCCAAGTCTAGCTGTATCTGGGG + Intergenic
1176243243 20:64084671-64084693 TCGAGGCCTAGATGGTTGTGGGG + Intronic
1180696867 22:17757112-17757134 CCGAAGCCTGGTGGTTTCTTAGG - Intronic
951367477 3:21801718-21801740 TGGAAGCCAAGATGTTTCTGTGG - Intronic
952581930 3:34844404-34844426 TCGAAGCTTAGTTGTTTCTATGG + Intergenic
955410130 3:58650087-58650109 CCATATCCTAGTTGTTTCTGTGG + Intronic
958984292 3:100762579-100762601 CTGAAGCCTAAAAGTATCTGGGG - Intronic
964637021 3:158869328-158869350 CCGAAGCTTGGATGATGCTGTGG + Intergenic
972340283 4:38146718-38146740 GCCTAGCCTAGATTTTTCTGTGG + Intergenic
976710712 4:88067957-88067979 TCGAAGCCTGGATGACTCTGAGG + Exonic
979439031 4:120729114-120729136 CCAGAGCCTTGATGTTTCTCAGG + Intronic
986443259 5:7799395-7799417 CAGAAGCCTAGAAGTTTCCCTGG + Intronic
988500864 5:31782655-31782677 AAGAAGCCCAGATGATTCTGGGG + Intronic
989730259 5:44640636-44640658 CAGCAGCATAGATGTTTCAGGGG - Intergenic
997200110 5:132004807-132004829 CCTAAGCCTAGGTCTGTCTGTGG - Intronic
997508526 5:134437252-134437274 TGGAAGCCAAGATGTTACTGAGG - Intergenic
1003900933 6:10654743-10654765 CTCAAGCCTAGGTGATTCTGAGG + Intergenic
1005990693 6:30899913-30899935 TCTAAGCCTATACGTTTCTGTGG + Intronic
1011744801 6:90399126-90399148 CTGGAGCCTAGAGGTTCCTGAGG - Intergenic
1022535824 7:31097684-31097706 CCGGACCCTAGATGTTTCCATGG - Intronic
1023674414 7:42615364-42615386 CCGAAGCCTGACTGCTTCTGTGG - Intergenic
1029617274 7:101666776-101666798 CAGAGCCCTTGATGTTTCTGAGG + Intergenic
1029671090 7:102031484-102031506 GCTTAGCCTAGATGTTTCTTGGG - Intronic
1036656211 8:10679048-10679070 CTGAGCCCTACATGTTTCTGGGG + Intronic
1037236822 8:16730157-16730179 CTGATGCCCAGATCTTTCTGAGG - Intergenic
1040357598 8:46634685-46634707 CTGAAGCCTACATGCTTCTTTGG - Intergenic
1044632101 8:94290056-94290078 CCGAAGCCCAGATATTTGTCTGG + Intergenic
1047647691 8:126886253-126886275 CCATAGCCTAGATGTATCTTTGG + Intergenic
1053312200 9:37027036-37027058 CCGCGGCCTCGATGCTTCTGAGG + Intronic
1053339969 9:37317256-37317278 CTAAAGCCTAGAAGATTCTGAGG + Intronic
1055793011 9:79943800-79943822 CCGAAGCCTAGATGCTAATCGGG - Intergenic
1056479392 9:86985630-86985652 CAGAAGCAGAGTTGTTTCTGAGG + Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058161613 9:101576116-101576138 GCAAAGCCTAAATGTTACTGAGG - Intronic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1187319311 X:18226186-18226208 CAGAGGCCTTGACGTTTCTGGGG + Intergenic
1188883487 X:35519496-35519518 CAAAAGCCTATATGTTTGTGGGG + Intergenic
1197394169 X:125905954-125905976 AAGAATCATAGATGTTTCTGAGG - Intergenic
1199053928 X:143270126-143270148 ACGGAGCCTAGGTGATTCTGTGG - Intergenic