ID: 1163251268

View in Genome Browser
Species Human (GRCh38)
Location 19:16127675-16127697
Sequence TGCACCCAAGAAGCCCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 100}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163251268_1163251272 9 Left 1163251268 19:16127675-16127697 CCAGCCGGGGCTTCTTGGGTGCA 0: 1
1: 0
2: 0
3: 11
4: 100
Right 1163251272 19:16127707-16127729 CATCTCATCAAAACCTACCATGG 0: 1
1: 0
2: 13
3: 34
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163251268 Original CRISPR TGCACCCAAGAAGCCCCGGC TGG (reversed) Intronic