ID: 1163251268 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 19:16127675-16127697 |
| Sequence | TGCACCCAAGAAGCCCCGGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 112 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 11, 4: 100} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1163251268_1163251272 | 9 | Left | 1163251268 | 19:16127675-16127697 | CCAGCCGGGGCTTCTTGGGTGCA | 0: 1 1: 0 2: 0 3: 11 4: 100 |
||
| Right | 1163251272 | 19:16127707-16127729 | CATCTCATCAAAACCTACCATGG | 0: 1 1: 0 2: 13 3: 34 4: 186 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1163251268 | Original CRISPR | TGCACCCAAGAAGCCCCGGC TGG (reversed) | Intronic | ||