ID: 1163251330

View in Genome Browser
Species Human (GRCh38)
Location 19:16127957-16127979
Sequence CATCTGAGCTTGCCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163251330_1163251333 -9 Left 1163251330 19:16127957-16127979 CCTGTTTTAGGCAAGCTCAGATG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1163251333 19:16127971-16127993 GCTCAGATGCGCCCGGCGGCTGG 0: 1
1: 0
2: 0
3: 6
4: 62
1163251330_1163251336 27 Left 1163251330 19:16127957-16127979 CCTGTTTTAGGCAAGCTCAGATG 0: 1
1: 0
2: 0
3: 7
4: 103
Right 1163251336 19:16128007-16128029 GTGCCTCCCTCTCTCACAGCTGG 0: 1
1: 0
2: 1
3: 27
4: 306

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163251330 Original CRISPR CATCTGAGCTTGCCTAAAAC AGG (reversed) Intronic
907949244 1:59165034-59165056 CATCTGAGGTTCCCTAATAGAGG + Intergenic
914714136 1:150240111-150240133 CTTCTGAGTTTGTCTAAAACTGG - Intergenic
915579810 1:156806670-156806692 CATCAGAGATTTCCTCAAACAGG - Intronic
915656905 1:157368245-157368267 CATCTGATCTTTCCCAAATCTGG - Intergenic
916705680 1:167346919-167346941 CATCTGAGCTGCCATAAAATGGG - Intronic
919645517 1:200090774-200090796 CATCTGTGCTGTCCTCAAACTGG - Intronic
923998218 1:239520792-239520814 CATCAAAGCTTCCCTAAAACAGG - Intronic
924599515 1:245476227-245476249 CATTTGTGGTTGCCTAGAACTGG + Intronic
1063584511 10:7339699-7339721 CATCTGAGCTTCCCTTAGACAGG + Intronic
1064073184 10:12247604-12247626 TATCTGAGCATGACTAAATCCGG - Intronic
1065789151 10:29243847-29243869 CATCTGAGGTTGGGAAAAACAGG - Intergenic
1075237869 10:120747526-120747548 CCTTGGAGCTTGCCTCAAACAGG + Intergenic
1079395477 11:20059092-20059114 GATCAGAGCTTGCCTCAGACAGG - Intronic
1080477537 11:32609435-32609457 CATCTGAGATTACCTCAGACTGG + Intronic
1085281458 11:75333805-75333827 CTTCTGTGCTTCCCTAAGACAGG - Intronic
1088665700 11:112091505-112091527 GATCTGAGCTCACCTAAAAAAGG - Intronic
1090451251 11:126808308-126808330 CATTGTAGCTTGCCAAAAACAGG - Intronic
1091526534 12:1307092-1307114 CAGCTGAGCTTTAGTAAAACAGG - Intronic
1091640383 12:2231837-2231859 CTCCTGATCTTGCCAAAAACTGG - Intronic
1092996804 12:13958664-13958686 AATCTGGGCTTGCCAAACACAGG - Intronic
1098853125 12:75621393-75621415 CATCTAGGCTAGCCTTAAACAGG + Intergenic
1099779996 12:87182502-87182524 CATCTGAGACTGCCTCAGACTGG - Intergenic
1100708544 12:97228530-97228552 CATCTGTGCTTTCCTTAAGCAGG + Intergenic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1112610652 13:100951737-100951759 CATCTGAGCTTCCCTCTAAATGG - Intergenic
1112808260 13:103186996-103187018 CATCTTAGAATGCCTAAAAAGGG - Intergenic
1113316028 13:109179964-109179986 CATTTGACCTTGGCTAAAATAGG + Intronic
1113370701 13:109722488-109722510 CATCTGAGCATGTCAATAACAGG - Intergenic
1116578747 14:46610387-46610409 CATCTGATCTTCCACAAAACTGG + Intergenic
1118578509 14:67269041-67269063 GATCAGTGGTTGCCTAAAACTGG - Intronic
1119948438 14:78719385-78719407 CATAGGAGGTTGCCTAAAAAGGG - Intronic
1126600816 15:50425387-50425409 CAGCAGAGCAAGCCTAAAACAGG - Intronic
1126863957 15:52917054-52917076 AATCTCAGCGTGCCTAACACAGG - Intergenic
1130244617 15:82233993-82234015 AATCTGACCTTGTCTAATACAGG + Intronic
1130456021 15:84109143-84109165 AATCTGACCTTGTCTAATACAGG - Intergenic
1131053809 15:89364030-89364052 CATCTGAGCTGGCCCAATGCTGG + Intergenic
1132074656 15:98809990-98810012 CATCCCAGCTTCCCTAAAGCGGG - Intronic
1144283276 17:13748083-13748105 CATCACAGCTTGCCCATAACAGG - Intergenic
1147457754 17:40548997-40549019 CAGCTGAGCTTCCCTGAAATCGG + Intergenic
1147896939 17:43757328-43757350 CAGCTGACCTTGCCTAGAAGGGG + Intronic
1150652875 17:67021361-67021383 CAGATGAGCTGGCCTGAAACAGG - Intronic
1150854082 17:68733973-68733995 TATCTGAGTATGCCTAAAAAAGG - Intergenic
1153374298 18:4357974-4357996 CATCTGTGCTTGCCCAAGGCTGG + Intronic
1157309351 18:46540515-46540537 AATCTGAGCTTTCCTGAGACTGG + Intronic
1157588447 18:48820170-48820192 AATCTTGGCTTCCCTAAAACTGG + Intronic
1158200082 18:54930310-54930332 CTTCTGAGCATTCCTAAAATGGG + Intronic
1160086547 18:75781954-75781976 CATCTGAGCGTGCCTGAGCCGGG - Intergenic
1162078475 19:8204915-8204937 CATCACAGCTGGCCTAAAATGGG + Intronic
1163251330 19:16127957-16127979 CATCTGAGCTTGCCTAAAACAGG - Intronic
939570356 2:143833199-143833221 CTTCTGAGCTGGCCTATCACTGG + Intergenic
940864399 2:158803703-158803725 CATCTGAGCTTGGCCAACACCGG + Intronic
947195336 2:227559507-227559529 CATCTGTGCTTGTCCAACACAGG + Intronic
1170344989 20:15375782-15375804 CATCTAAACTAGCCTAAAAAGGG + Intronic
1172173476 20:32958745-32958767 CAGCTGAGCTGGGCTAAAATAGG - Intronic
1179115705 21:38490079-38490101 CATTGGAGATTGCTTAAAACAGG - Intronic
1182683476 22:32101616-32101638 CATCTGAATATGCCTAAATCTGG + Intronic
1183239281 22:36644226-36644248 CAGCTGAACTGGGCTAAAACTGG + Intronic
949731977 3:7124250-7124272 CATTTGAACTTTCCTGAAACTGG - Intronic
957955533 3:87181807-87181829 CATCTGCTCTTGCTTAACACTGG + Intergenic
959219195 3:103494392-103494414 CATCTTAGCTTTTATAAAACTGG + Intergenic
961364303 3:126389636-126389658 CATCTGCGCGTGGCTCAAACAGG + Intergenic
965408571 3:168301587-168301609 CATCTCAGCTTCCCTTCAACTGG + Intergenic
965691909 3:171366328-171366350 AATCTAACCTTGCCCAAAACAGG + Intronic
967080363 3:186044148-186044170 CTTCAGAGCTTGCTTAAAAATGG + Intergenic
970382523 4:15522368-15522390 CAACTGGGCTTGACTCAAACGGG - Intronic
972936137 4:44138331-44138353 CATCTGGTCTTGCCTAAGAGGGG - Intergenic
976347646 4:84023662-84023684 AATCCAAGCTTGCCTAAATCAGG - Intergenic
979434634 4:120673839-120673861 GATTTGAGCTTGCCTTAAATTGG - Intergenic
980187022 4:129475267-129475289 GATCTAAGCTTGCCTTAAATTGG + Intergenic
981595091 4:146411211-146411233 CATCTGAGTTTCCCAAAAGCAGG + Intronic
985645891 5:1084608-1084630 CAGCTGTGCTTCCCTAAAACGGG + Intronic
987881517 5:23751329-23751351 CATCTGAGATTGCCTCACCCTGG + Intergenic
988789873 5:34597655-34597677 CATTTGGGCTTGGCAAAAACAGG + Intergenic
990303362 5:54471607-54471629 CATGGGAGATTGCCTAAGACAGG + Intergenic
990318320 5:54605223-54605245 CATCTAAAATTGCCCAAAACAGG - Intergenic
991074167 5:62516633-62516655 TATCTGAAATTGCCTTAAACAGG - Intronic
993772578 5:91948702-91948724 CATCTGAGTTAGATTAAAACCGG - Intergenic
995608045 5:113879472-113879494 CATCTGAGCCTACCTCAACCTGG - Intergenic
1007962835 6:45976378-45976400 CATCCCAGCTTGCCTAGGACTGG + Intronic
1009763876 6:68042783-68042805 CAACTGAGCTTTCCTAAAATGGG + Intergenic
1009831616 6:68944115-68944137 CATTGTATCTTGCCTAAAACTGG + Intronic
1011902782 6:92321296-92321318 CTTTTGACCTTTCCTAAAACAGG + Intergenic
1017416626 6:154227810-154227832 CAGCTGAGATTCCCTTAAACAGG + Intronic
1018811609 6:167302213-167302235 CAGCTGAGCGTTCCTGAAACTGG - Intronic
1020749377 7:12121541-12121563 CATGTGAGCTGGGCTAAAGCAGG - Intergenic
1028285537 7:88992522-88992544 CATCTGGGCTGGCCTTAAGCGGG + Intronic
1028708684 7:93882069-93882091 CCTATGGGCTTGCCTAAACCTGG - Intronic
1030618521 7:111764021-111764043 CAGGTGGGCCTGCCTAAAACTGG - Intronic
1035079188 7:156202143-156202165 CATCTGAGCTTGGGAAAAGCAGG - Intergenic
1037284656 8:17286065-17286087 CATGAGAGGTTCCCTAAAACAGG + Intronic
1037284818 8:17287922-17287944 CATGAGAGGTTCCCTAAAACAGG + Intronic
1040534309 8:48294482-48294504 CATCTGAGCTTTCCTCTAGCAGG + Intergenic
1040689640 8:49920297-49920319 CACATGAGATTCCCTAAAACAGG - Intronic
1044235508 8:89825627-89825649 CATCTCAGCTGCCCTAAAGCTGG + Intergenic
1045936914 8:107690555-107690577 CAGCTGAGCTTCCCAAACACAGG + Intergenic
1046857267 8:119047236-119047258 CATCTGAGCTTTGGTGAAACTGG + Intronic
1046874976 8:119244415-119244437 CATCTGAGAGTGCTTAAAATGGG + Exonic
1047182859 8:122605808-122605830 CATCTGAGCTTCCCAGAGACTGG + Intergenic
1048603643 8:135945315-135945337 CATGTGAGCTTCCTTATAACTGG + Intergenic
1050935666 9:11392103-11392125 CATCTGAGATTACCTCAACCTGG - Intergenic
1055567387 9:77582778-77582800 TATCTGTGCTTGCCTAACATAGG + Intronic
1056152054 9:83800746-83800768 CACCTGTGATTGGCTAAAACTGG - Intronic
1058834589 9:108849684-108849706 CATCTGAGCCTGCCTCAGCCTGG + Intergenic
1059469162 9:114491268-114491290 CATCTGAGCTTGAATTAAATTGG - Intronic
1061776872 9:132971441-132971463 CATCTGAGGTTCCCTAAGACAGG + Intronic
1062286956 9:135777638-135777660 CCTCTCAGCTTTCCTAAAAAGGG + Intronic
1186214728 X:7287826-7287848 CATTTGATATTGCCTAAAATAGG + Intronic
1189163764 X:38838493-38838515 CATCTAAGCTTCCCAAACACTGG + Intergenic
1194103573 X:89738504-89738526 TATATGAGCTTGCCCAACACTGG + Intergenic
1195038016 X:100987808-100987830 CATTAGAGCTTCCCCAAAACAGG + Intronic
1196546922 X:116973988-116974010 CATCTGAGATTACCTACATCTGG - Intergenic