ID: 1163256724

View in Genome Browser
Species Human (GRCh38)
Location 19:16160547-16160569
Sequence GTAGCTGCTTAATTTATTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163256712_1163256724 30 Left 1163256712 19:16160494-16160516 CCTTGGCCTCCCAAATGCTGGGG 0: 4
1: 132
2: 658
3: 2241
4: 15596
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data
1163256714_1163256724 24 Left 1163256714 19:16160500-16160522 CCTCCCAAATGCTGGGGTTACAG 0: 4
1: 364
2: 1854
3: 6197
4: 8041
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data
1163256717_1163256724 20 Left 1163256717 19:16160504-16160526 CCAAATGCTGGGGTTACAGGCTT No data
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data
1163256719_1163256724 -9 Left 1163256719 19:16160533-16160555 CCGTGCCCAGCCCAGTAGCTGCT No data
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data
1163256716_1163256724 21 Left 1163256716 19:16160503-16160525 CCCAAATGCTGGGGTTACAGGCT 0: 9
1: 579
2: 20622
3: 249368
4: 286039
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data
1163256718_1163256724 -6 Left 1163256718 19:16160530-16160552 CCACCGTGCCCAGCCCAGTAGCT No data
Right 1163256724 19:16160547-16160569 GTAGCTGCTTAATTTATTAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163256724 Original CRISPR GTAGCTGCTTAATTTATTAG CGG Intergenic
No off target data available for this crispr