ID: 1163258172

View in Genome Browser
Species Human (GRCh38)
Location 19:16170358-16170380
Sequence CTTCTAAAGCAGATGGAGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258166_1163258172 24 Left 1163258166 19:16170311-16170333 CCTGGAAGAGGGGACATTGGTTC No data
Right 1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG 0: 1
1: 0
2: 5
3: 25
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258172 Original CRISPR CTTCTAAAGCAGATGGAGTT GGG Intronic
902960519 1:19959984-19960006 CCTCTAAAGCAGTTGGACTGAGG - Intergenic
906788895 1:48641511-48641533 CTTCAAAGGCAGAAGGACTTGGG + Intronic
907733725 1:57091922-57091944 CTTCTTAACTGGATGGAGTTGGG - Intronic
908080161 1:60568634-60568656 TTTATAAAGCAGCTGTAGTTTGG + Intergenic
909840694 1:80319187-80319209 TTTCAAAAGCAGATGCATTTGGG - Intergenic
915853423 1:159352865-159352887 CTTCAGAAGCAGATGCAGATGGG + Intergenic
919071925 1:192766633-192766655 ATTCTAAAGGATATGGTGTTGGG + Intergenic
921447792 1:215266749-215266771 CTTCTTCAGCAGAAGGACTTTGG + Intergenic
922352472 1:224745564-224745586 CTTCTAGAGCAGAGGAAGTAGGG + Intergenic
922386256 1:225087045-225087067 CTTCTAAGCAAGATGGAGTTTGG + Intronic
924334064 1:242969165-242969187 GTTCTAAAGCAGATGCAGTTTGG - Intergenic
1062970202 10:1642204-1642226 CTTCAAAAGCACACGGATTTTGG + Intronic
1063569613 10:7203185-7203207 CTTCTAAAGCTGCTAGAGTCTGG + Intronic
1063790635 10:9442206-9442228 GTTCTACAGCAGATGGCCTTTGG + Intergenic
1064243390 10:13650520-13650542 CTGCTAAAGGTGATGGAGATAGG - Intronic
1066663669 10:37761051-37761073 TTTGAAAGGCAGATGGAGTTGGG - Intergenic
1067940500 10:50650992-50651014 CTTCTCTACCAGATGGTGTTTGG - Intergenic
1068741478 10:60477437-60477459 TTTCTAAAGCAAAATGAGTTGGG + Intronic
1069275362 10:66585008-66585030 CTTATAAGCCAGATGGAATTGGG - Intronic
1069859641 10:71462359-71462381 CCTCTAAAGCAGATGGCGGTGGG - Intronic
1072621730 10:97084202-97084224 CTTCTAGAGAAGCAGGAGTTGGG - Intronic
1073139501 10:101238053-101238075 ATTCGAACGCAGATGGGGTTTGG + Intergenic
1073727539 10:106251474-106251496 CCTCAACCGCAGATGGAGTTAGG - Intergenic
1073821191 10:107266157-107266179 CTTCTAAATGAAATGAAGTTGGG + Intergenic
1076815621 10:132913388-132913410 CTGTAAATGCAGATGGAGTTTGG - Intronic
1081029574 11:38061701-38061723 CTGACAAAGCAGATGGAGTTGGG - Intergenic
1083891559 11:65598250-65598272 CTCCTAAGGCAGCTGGAGCTCGG + Exonic
1085429474 11:76435019-76435041 CTTCTAAAAAAGAGGGAATTTGG + Intergenic
1085741827 11:79083676-79083698 GTTCTAAGGCATATGGAGTTAGG - Intronic
1087681223 11:101220074-101220096 CTGTTAAAGCAGGGGGAGTTTGG - Intergenic
1087779642 11:102288621-102288643 CTGCTACAACAGATGGAGGTCGG - Intergenic
1088405963 11:109479359-109479381 CTTCAAAAGGAGAAAGAGTTGGG - Intergenic
1088551944 11:111022152-111022174 CTTGGAAAGCAGATGGGGTGGGG - Intergenic
1090457770 11:126864780-126864802 CCTCTAAAGCTGATGGAGCTAGG + Intronic
1091844225 12:3643018-3643040 CTTTCAAAGCAGAATGAGTTTGG + Intronic
1092045321 12:5428445-5428467 CTGCTAGAGCTGATGGAGTCTGG - Intergenic
1094530021 12:31265666-31265688 CTCTGAAAGCAGATGGAGCTAGG + Intergenic
1094784672 12:33833663-33833685 CTTCTAAAGCAGAAGACGTTTGG + Intergenic
1096339791 12:50788014-50788036 CTTCTTTAGCATTTGGAGTTTGG + Intronic
1096535964 12:52274881-52274903 CTTCTAGGGCAGATGGAGTGTGG - Intronic
1096657439 12:53100482-53100504 CTTATAAAGGAGATGAATTTTGG - Intronic
1098956547 12:76694944-76694966 CTTCTACAGAATCTGGAGTTAGG + Intergenic
1099163879 12:79277332-79277354 CTTCTAAACCAGAAGGCCTTGGG + Intronic
1100722751 12:97376018-97376040 CTTTGAAATCAGATGGATTTGGG + Intergenic
1100781027 12:98026452-98026474 ATGCCAAAACAGATGGAGTTTGG + Intergenic
1101040306 12:100748577-100748599 CTTCTAGAGAACATAGAGTTGGG + Intronic
1103377499 12:120468847-120468869 CTTCTAAAACAGCCGGAGTGGGG - Intronic
1108013696 13:46050985-46051007 CCTCTATATGAGATGGAGTTGGG + Intronic
1118508220 14:66440320-66440342 CTTCTAAAACACATGGAGATAGG + Intergenic
1120108499 14:80524361-80524383 CTTCTGAAACTGATGGAGTAAGG + Intronic
1120752901 14:88214795-88214817 CTTTTAAAGCAGATGAAGACAGG + Intronic
1124406850 15:29400801-29400823 CTTCTAATGCAGATGCAGAGAGG - Intronic
1125113180 15:36057769-36057791 CTTGTAGAGCAGGTGGAGTTTGG + Intergenic
1126337235 15:47599461-47599483 CTCAAAAAGTAGATGGAGTTTGG + Intronic
1126968324 15:54082113-54082135 CTTCTAAACCAGAAGAAATTAGG - Intronic
1127365836 15:58288982-58289004 GTTCTAAAGCTGATGAAATTAGG + Intronic
1130238677 15:82164455-82164477 CTTCTAAAACAGGGGGAGTATGG - Intronic
1131950172 15:97673299-97673321 TTTCTCAAGCAAAAGGAGTTTGG + Intergenic
1133518164 16:6530212-6530234 CCTCTAGATCTGATGGAGTTTGG + Intronic
1133624605 16:7559461-7559483 TTTTTAAGGCAGATGGGGTTGGG - Intronic
1134991960 16:18708171-18708193 CTTCTCCAGCACATGGTGTTAGG + Intergenic
1137379321 16:47982833-47982855 CATCAAAAGGAGATGGAATTTGG - Intergenic
1139332450 16:66203894-66203916 ATTCCAAAGGAGATGGAATTGGG - Intergenic
1141083935 16:81077769-81077791 TTTCTAAAGCAGAAGGGCTTTGG - Intergenic
1143134984 17:4707482-4707504 TTTTTAAAGCAGAGGGGGTTGGG - Intergenic
1146743219 17:35304883-35304905 CTTCTACAGAATCTGGAGTTGGG - Intergenic
1146780832 17:35670620-35670642 CTTGTAAAGAAGACGGAGCTGGG - Intronic
1148066526 17:44874737-44874759 CTTCTCAACAAGATGGATTTAGG - Intronic
1148085558 17:44991814-44991836 CTTCTGAAGCAGGTGGAGCTGGG - Intergenic
1149344942 17:55725336-55725358 TTTCTAAAGCACATGGCTTTAGG + Intronic
1150473492 17:65457335-65457357 CATCTAGAGCAGGTGGAGTTGGG - Intergenic
1151444835 17:74156418-74156440 TTTTTAAAGCAGACGGAATTTGG - Intergenic
1151752635 17:76049367-76049389 CTTGAAAAACAGATGGGGTTTGG + Intronic
1151800907 17:76379134-76379156 CTACTAAAGGGGATGGAGGTGGG + Intronic
1152171014 17:78748619-78748641 CTTCTAAACCAAATTCAGTTAGG + Intronic
1154969982 18:21398179-21398201 ATTCTAAAGCACATGGTCTTTGG - Intronic
1159333671 18:67035188-67035210 CTTCTAAAGCAAAAGGGATTTGG + Intergenic
1161070535 19:2257764-2257786 TTTCTAAAGCGGAGGGAGTGGGG - Intronic
1163258172 19:16170358-16170380 CTTCTAAAGCAGATGGAGTTGGG + Intronic
1164778136 19:30870644-30870666 CTTCTTAAGTATATGTAGTTAGG + Intergenic
1165884648 19:39069290-39069312 ATTCTGAAACAAATGGAGTTTGG + Intergenic
1167055769 19:47111250-47111272 CTGCTCGAGCAGAAGGAGTTGGG - Intronic
925027858 2:623748-623770 CCTCTAAAGCAAATGGAGGATGG + Intergenic
925492528 2:4410893-4410915 CTTCTGTAGCAGATGTAGTCAGG + Intergenic
926361969 2:12097610-12097632 GTTTAAAAGAAGATGGAGTTGGG + Intergenic
926766991 2:16330544-16330566 TTCCTAAAGCAGAAGGAGGTGGG - Intergenic
927178728 2:20428680-20428702 CTCATAAAGCACATGCAGTTTGG + Intergenic
927186212 2:20484396-20484418 CTTCTATAGCAGAGGGAGCCAGG + Intergenic
928582404 2:32722578-32722600 CTTCTAAATCAGGTGGACCTGGG - Intronic
929484615 2:42342467-42342489 AAAGTAAAGCAGATGGAGTTAGG - Intronic
930535525 2:52641381-52641403 TTTCTAAAACTGAAGGAGTTGGG + Intergenic
932624449 2:73286062-73286084 CTGCAAGAGCAGATGGATTTGGG - Intergenic
936618276 2:114070510-114070532 ATTCCAAAGCTGGTGGAGTTAGG - Intergenic
936656189 2:114490349-114490371 CTTCTATAGCTGATGGAAGTAGG - Intronic
937506871 2:122547454-122547476 CATTTAAAACAGTTGGAGTTAGG - Intergenic
938186276 2:129234737-129234759 CGTTTAAATCAGATGGTGTTTGG - Intergenic
938774358 2:134528380-134528402 TCTCTAAAGGAAATGGAGTTAGG - Intronic
940085969 2:149859387-149859409 CTTCTAAACCAGATGCACTTTGG - Intergenic
942143225 2:172998963-172998985 CCTCTAAAAGAGATGGAGATTGG + Intronic
943573524 2:189602818-189602840 CCTTTAAAGAAGAAGGAGTTGGG + Intergenic
944858548 2:203792049-203792071 CTCTTGAAGGAGATGGAGTTGGG + Intergenic
945003725 2:205378977-205378999 CTTCTAAAGCAGCTGCTGATAGG + Intronic
946220084 2:218218020-218218042 CTTTTAAAGGAGATGGGGGTGGG - Intronic
1170358926 20:15523172-15523194 CTTTTAAATCATATGGAGTCAGG - Intronic
1175476719 20:59280688-59280710 CTTCTAAATCATAAGTAGTTCGG - Intergenic
1177009459 21:15714736-15714758 CTTCAAAAGTAGAAGGAATTAGG + Intergenic
1177037060 21:16057304-16057326 CTTCTAAGGCAGATATAGTTCGG - Intergenic
1177047761 21:16191517-16191539 CTTCTAAAGCTAATGATGTTGGG - Intergenic
1178736970 21:35161264-35161286 CTTCTACAGAAGATGGAGCTTGG - Intronic
1178855970 21:36250741-36250763 CTTCCGCAGCAGATGGAGTCAGG + Intronic
1179878845 21:44285174-44285196 CTTCTAAAGCACCTGGAGGAAGG + Intergenic
1180698712 22:17770194-17770216 CTTAAAATGCAGATGGACTTGGG - Intronic
1182549426 22:31092972-31092994 TGTCTAAAACAGCTGGAGTTAGG + Intronic
1183331619 22:37225291-37225313 CTGCTTAAGCAGGTTGAGTTGGG + Exonic
1184439709 22:44501701-44501723 CTTCTAAATCAGATGGGGGCAGG + Intergenic
949520046 3:4843153-4843175 CTGCTAAAGGAGAAGGAATTGGG - Intronic
952275020 3:31868401-31868423 CTTCAAAACCCGATGGAGCTCGG - Intronic
955054195 3:55441600-55441622 CTTTGAAAGCAGAGGAAGTTGGG + Intergenic
955124283 3:56094955-56094977 GTGCTAAAACAGATGGGGTTGGG + Intronic
956835461 3:73092777-73092799 CTCCAAAAGCAGATGGAAGTTGG - Intergenic
959184356 3:103026721-103026743 CATCTAAAGCAGTTGGATATTGG + Intergenic
962968466 3:140376284-140376306 CATCTATAGCTGATGGAGGTGGG - Intronic
963382343 3:144547481-144547503 CTTATAAAACACATGGAGGTAGG - Intergenic
964118228 3:153158264-153158286 CTTCTAACACAAATAGAGTTTGG + Intergenic
964223360 3:154370158-154370180 CTTCTACAGAATATGGAGTTAGG - Intronic
964535194 3:157713877-157713899 CTTTCAAATCAGATGCAGTTTGG + Intergenic
964540271 3:157771975-157771997 CGTATAAAGCAGGCGGAGTTGGG + Intergenic
966337168 3:178881301-178881323 ATTCTAAGGTAGAAGGAGTTCGG + Intergenic
970449361 4:16151575-16151597 CTCTTAAAGCTGCTGGAGTTGGG + Intergenic
972079060 4:35126698-35126720 ATAATAAAGCAGATGGAGATTGG - Intergenic
972134103 4:35870489-35870511 ATTGTAAAGCAGACGGAGTTGGG - Intergenic
972481210 4:39498049-39498071 ATGCTAAAGCAGATAGAATTAGG - Intergenic
972873679 4:43331103-43331125 CTTCTACAGCAGATAGTGTTAGG - Intergenic
973793806 4:54403296-54403318 CTGCCAAAGCAGCTGGAATTTGG + Intergenic
973862610 4:55080014-55080036 CTTTTAAAGCTGATAGAGATTGG - Exonic
976085685 4:81404877-81404899 CTTCTAAAGTAGATAAGGTTTGG + Intergenic
976121577 4:81789319-81789341 ATTCTAGAGCAGATGGCCTTTGG - Intronic
979243046 4:118466135-118466157 GTTCTAAAGCAGATGCAGTTTGG + Intergenic
980441639 4:132855128-132855150 CCTCTCAAGCAGATGGAGTTGGG + Intergenic
980986551 4:139700908-139700930 CTTTGAAAGCAGCTGGATTTTGG - Intronic
983152774 4:164305367-164305389 CTTCTAAAGAAGTAGGAGTGGGG + Intronic
984134613 4:175920052-175920074 CCTCTAAAGGTGATGGAGCTTGG + Intronic
984396246 4:179203732-179203754 ATTCTAAATCTGATGGAGTAGGG + Intergenic
986068377 5:4258115-4258137 GTTATAAAGAAGATGCAGTTGGG + Intergenic
986100296 5:4602240-4602262 TTTCTAAAGCAGATGGAAGAAGG - Intergenic
986666240 5:10107482-10107504 TTTCTAGAGCTGGTGGAGTTCGG + Intergenic
986899236 5:12412114-12412136 CTCCTAAAGCAGATACAGCTTGG - Intergenic
987526696 5:19059827-19059849 CTTCTAGAGCAGATCAAGCTGGG - Intergenic
988298000 5:29390853-29390875 CTTCCATAGCGGATGGAGGTGGG - Intergenic
991297855 5:65100829-65100851 CTTCAAAAGGAGATGGAGGTGGG - Intergenic
992296202 5:75329253-75329275 CTTCCAAAGCCCATGGATTTGGG - Intergenic
993762754 5:91817119-91817141 TTAATAAAGCAGAAGGAGTTGGG - Intergenic
995291974 5:110467455-110467477 ATTCTAAAGCTTATGCAGTTGGG + Intronic
995402240 5:111756625-111756647 CTTATAAAGCAGTTGAACTTTGG - Intronic
996528984 5:124507752-124507774 CTTCTAACTCAGATAGACTTGGG - Intergenic
1001479058 5:172074611-172074633 CTTCTAAAGCATGTGATGTTGGG + Intronic
1002070388 5:176675945-176675967 CTTCAAAAGCAGGTGGGGCTAGG + Intergenic
1003661806 6:8069271-8069293 TTTCTCAAGCAGATGAAGGTGGG + Intronic
1004112209 6:12730020-12730042 CATTTAAAGCATATTGAGTTTGG + Intronic
1004565500 6:16792134-16792156 CTTCTACAGAACATGGGGTTTGG - Intergenic
1005244804 6:23870597-23870619 TTTCTAAAGAAGATGGTGTTTGG - Intergenic
1005286277 6:24330481-24330503 CTTCAAAAGGAGAAGGAATTTGG + Intronic
1006128713 6:31855440-31855462 CTCCTAGAGTAGATAGAGTTGGG - Intergenic
1007533802 6:42566271-42566293 ATTCTCAAGCAGATGCAGTAAGG + Intronic
1008177338 6:48285176-48285198 TTTCTCAAGCAGAAGGAATTTGG + Intergenic
1009864800 6:69383926-69383948 GTTCTAAAGTAGATGACGTTTGG + Intronic
1010050315 6:71496552-71496574 CCTCTAAACCACATAGAGTTTGG + Intergenic
1014967573 6:127774833-127774855 CTTCTAAAGCAAATAGATTGAGG + Intronic
1015233003 6:130938097-130938119 GTTGTAAAGCAGAGGGAGATAGG + Intronic
1016076051 6:139796972-139796994 CTTCTCAACTAGATAGAGTTTGG + Intergenic
1017143079 6:151209450-151209472 CTTCTACTGCAGATTGAGTCGGG + Intergenic
1019509572 7:1411057-1411079 CTCCTAGAGCAGATGGAGCTCGG + Intergenic
1021044754 7:15908838-15908860 CTTCTAAAGTAGAAGGACTGAGG - Intergenic
1021111135 7:16696033-16696055 CTTCAAAAGCAGAAGGAGCCGGG - Intronic
1021830400 7:24602034-24602056 CATCTAAACCAGATGGGTTTTGG - Intronic
1024569002 7:50709105-50709127 TTTCTAAAGCATGTGGATTTGGG - Intronic
1025665281 7:63579986-63580008 ATTCTTAAGCAGTTAGAGTTGGG + Intergenic
1030574514 7:111268984-111269006 CTTCTAAAGTAGGTGGAGCAAGG + Intronic
1032010421 7:128343526-128343548 CATCTAAAGCAGAATCAGTTTGG + Intronic
1032398447 7:131607418-131607440 TTTCTGAAGCACATGCAGTTTGG - Intergenic
1033691470 7:143741243-143741265 CCTCTAAAGTAGATACAGTTTGG + Intergenic
1034459447 7:151190439-151190461 CTTATAAAGCAGAGAGAGATTGG - Intergenic
1034745753 7:153522498-153522520 CTTATAAAGCAGAGGGAGATCGG + Intergenic
1037563858 8:20099555-20099577 CTTCTAAAACAGGAAGAGTTGGG + Intergenic
1037677912 8:21067754-21067776 CTTAACAATCAGATGGAGTTTGG + Intergenic
1038285206 8:26200294-26200316 CTTCATAAGCAGAGGGAATTTGG + Intergenic
1038384312 8:27127501-27127523 ATTATAAAGCAGATGGAGCCGGG - Intergenic
1039085776 8:33778099-33778121 GTTTCCAAGCAGATGGAGTTGGG - Intergenic
1039207283 8:35171436-35171458 CTTCCAAACCAGAAGGAATTGGG + Intergenic
1043373547 8:79621641-79621663 CCCTTAAAGCAGATTGAGTTGGG - Intronic
1044546156 8:93462176-93462198 CTTATATAGTAGATGGTGTTGGG + Intergenic
1045242725 8:100416579-100416601 CTCCTAAAGCAGTTGGAGGCGGG - Intergenic
1045861442 8:106818819-106818841 CTTCTAAATGATATGGAATTGGG + Intergenic
1051977204 9:22965416-22965438 ATCCTAAAACAGATGGAGTTTGG - Intergenic
1055979580 9:81988897-81988919 CCACTCAAGCAGATGAAGTTGGG - Exonic
1056424708 9:86465016-86465038 TTTCTCAAGCAGAAGGAGTTTGG + Intergenic
1056814567 9:89792037-89792059 CTTCTTAAGCAGCTGGAGTGCGG + Intergenic
1057902054 9:98957051-98957073 GTTCTATAGCAAAGGGAGTTAGG + Intronic
1058840720 9:108906254-108906276 CATGTTAAGCAAATGGAGTTAGG - Intronic
1061357039 9:130113787-130113809 CTTCTAAAGATGAGGGAGGTGGG - Intronic
1061578487 9:131522593-131522615 CTTCTAAACCAGAGTGTGTTTGG + Intronic
1186359912 X:8830153-8830175 CTTCTACATCATATGCAGTTGGG + Intergenic
1186366965 X:8905751-8905773 TTTATAAAGCATATGGAATTAGG - Intergenic
1186815914 X:13238017-13238039 CTTCACATGCAGATGGAGGTGGG - Intergenic
1187404383 X:18989555-18989577 CTGCTCAAGCAGATGTAGGTAGG + Exonic
1187636560 X:21235649-21235671 CTTGTAAACAAAATGGAGTTGGG - Intergenic
1190014782 X:46817611-46817633 ATTCCAAGGCAGTTGGAGTTAGG + Intergenic
1193417207 X:81238982-81239004 CTTCTGAAGCAGCTGCAGCTTGG + Intronic
1194165062 X:90505818-90505840 TTCCTCAAGCAGAAGGAGTTTGG - Intergenic
1195992763 X:110699007-110699029 ACTATAAAGCAGATAGAGTTGGG + Intronic
1196017322 X:110953796-110953818 CTTCTTAAGAAGAGCGAGTTTGG + Intronic
1196373616 X:115005932-115005954 CTTAAAAAGCAGACGAAGTTTGG + Intronic
1197803116 X:130372784-130372806 ATTTTAAAGCAGATGCAGCTTGG + Intronic
1197828584 X:130616600-130616622 CTCCTAAAGAACTTGGAGTTAGG - Intergenic
1199458438 X:148055883-148055905 CTTCTCCAGAAGATGGAGTTAGG - Intergenic
1201981728 Y:19916457-19916479 CTTCTAAGGAATCTGGAGTTAGG + Intergenic
1202390768 Y:24368216-24368238 GTTCTAAAGCAGATGCAGTTTGG + Intergenic
1202480016 Y:25301900-25301922 GTTCTAAAGCAGATGCAGTTTGG - Intergenic
1202604146 Y:26624900-26624922 CTTCTGATGCAGATGAAGTCTGG - Intergenic