ID: 1163258185

View in Genome Browser
Species Human (GRCh38)
Location 19:16170483-16170505
Sequence TATGAAAGTGAAGGTATCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 214}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258185_1163258188 2 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258188 19:16170508-16170530 TTCCCTTCCTCTCCTTATAATGG 0: 1
1: 1
2: 11
3: 94
4: 427
1163258185_1163258192 6 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258192 19:16170512-16170534 CTTCCTCTCCTTATAATGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 144
1163258185_1163258197 25 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258197 19:16170531-16170553 GAGGAAGAGGCCGGATGCAGCGG 0: 1
1: 1
2: 29
3: 280
4: 1881
1163258185_1163258189 3 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258189 19:16170509-16170531 TCCCTTCCTCTCCTTATAATGGG 0: 1
1: 0
2: 4
3: 28
4: 215
1163258185_1163258194 12 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258194 19:16170518-16170540 CTCCTTATAATGGGAGGAAGAGG 0: 1
1: 0
2: 1
3: 21
4: 188
1163258185_1163258196 16 Left 1163258185 19:16170483-16170505 CCAAAGATACCTTCACTTTCATA 0: 1
1: 0
2: 0
3: 18
4: 214
Right 1163258196 19:16170522-16170544 TTATAATGGGAGGAAGAGGCCGG 0: 1
1: 0
2: 0
3: 45
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258185 Original CRISPR TATGAAAGTGAAGGTATCTT TGG (reversed) Intronic
901085527 1:6609499-6609521 TAGGAAGGTGAAGCTATATTTGG + Intronic
902074848 1:13776183-13776205 TATTAAAGTGAAGCTCTCTATGG + Intronic
902222248 1:14974023-14974045 TATGTGAGTGAAGCCATCTTGGG - Intronic
906085510 1:43129981-43130003 GGGGAAAGTGAAGGTGTCTTGGG - Intergenic
907534604 1:55138608-55138630 CTCGACAGTGAAGGTATCTTTGG + Exonic
909691686 1:78414504-78414526 TAGGACAGGGAAGGTATCTCTGG - Intronic
910350357 1:86289465-86289487 TATGAATGTGCATGTGTCTTTGG - Intergenic
913390016 1:118300211-118300233 TAAGAAGGTGAAGGTTTATTGGG + Intergenic
919185569 1:194143311-194143333 TGTGAAAGAGATGGTATTTTAGG - Intergenic
919875599 1:201864641-201864663 TATGAATGTGAAAGTACTTTGGG + Intronic
924141171 1:241025118-241025140 TATGAAAGGCAAAGTATTTTAGG + Intronic
1063071304 10:2669087-2669109 TAAGTAAGTGAAGGTTTCTGGGG - Intergenic
1063291792 10:4757351-4757373 AAGGAAAGTGAAGTTATGTTAGG + Intergenic
1063296972 10:4816541-4816563 TATGAATGTGTATGTGTCTTTGG + Intronic
1064480401 10:15734975-15734997 TATAAAAGGTAAGTTATCTTGGG - Intergenic
1065130666 10:22616574-22616596 TAGGAATTTGAAAGTATCTTGGG - Intronic
1065673888 10:28153612-28153634 TATGTAAATGAAGGTAACTATGG - Intronic
1066486999 10:35855917-35855939 TAAGAAATTGAAGCTATCTTGGG + Intergenic
1067307939 10:45083194-45083216 TAAGAAATTGAAGCTATCTTAGG + Intergenic
1068241571 10:54308599-54308621 TATGAAAGCAAAGGAATCCTTGG - Intronic
1069070844 10:63989192-63989214 TATGAAAGTAGAGGTATTTTTGG + Intergenic
1070947429 10:80404930-80404952 TTTGAATGTGAAGATATCTAAGG + Intergenic
1070962946 10:80511645-80511667 AATGGCAGTGAAGGTATCTCCGG - Intronic
1071185393 10:83037966-83037988 TATGAAAGTGAGGGCGTCTAAGG - Intergenic
1071886442 10:89955961-89955983 TATGATGGTGTAGGCATCTTTGG - Intergenic
1074179828 10:111049589-111049611 TTTGAAAGCAAAGTTATCTTGGG - Intergenic
1074624882 10:115171776-115171798 TGTGAAGGTGAAGGTGTCTAGGG + Intronic
1076256355 10:129028502-129028524 TATGAAAGGGCAGCTGTCTTAGG + Intergenic
1078940173 11:15994314-15994336 TATGAATGTGAAACTATTTTGGG + Intronic
1081035605 11:38141083-38141105 GATGGAAGTGATGGTTTCTTGGG + Intergenic
1085760956 11:79241167-79241189 TATGAAAGGGAAGGCCTCCTGGG + Intronic
1087598606 11:100285310-100285332 TCTCACAGTGAGGGTATCTTGGG - Intronic
1087771598 11:102216251-102216273 TGTGAAAGTGAAGTTACCATAGG + Intronic
1088059585 11:105630604-105630626 TATGAAAATGAAGGGATTTAAGG + Intronic
1089129927 11:116203462-116203484 TCTGAAAGTGCAGGGATCTGAGG - Intergenic
1089975363 11:122727464-122727486 TTTAGAAGTGAAGGCATCTTGGG - Intronic
1090247937 11:125230002-125230024 TATGAATATGAAGTTATCTTAGG - Intronic
1090606782 11:128429800-128429822 TATGGAAGTAAAGATATGTTAGG + Intergenic
1091346152 11:134855545-134855567 TATGAAAGGGAAATTATCTTGGG + Intergenic
1091963357 12:4718134-4718156 TGTGTCAGTGAAGGTCTCTTGGG - Intronic
1092393533 12:8103745-8103767 TATAAAAGGGAAGGTATTCTAGG - Intergenic
1093821323 12:23621888-23621910 TATGAAAAAGAAGCTAGCTTTGG - Intronic
1094679005 12:32650706-32650728 TAAGAAAGTGATGGTAGCCTAGG - Intergenic
1095881297 12:47139632-47139654 TATGAAAGGGAATGTATGTGTGG + Intronic
1099857817 12:88190277-88190299 TTTAGAAGTCAAGGTATCTTAGG + Intronic
1100631527 12:96394398-96394420 AATGAAAGAGAAATTATCTTTGG + Intronic
1100637864 12:96453006-96453028 CATGCAAGTTCAGGTATCTTTGG - Intergenic
1101412569 12:104481633-104481655 TAAGAAAGGGAAGGCATTTTTGG + Intronic
1101436873 12:104671660-104671682 TCTGTAAGTAAAGGAATCTTTGG - Intronic
1102193110 12:111004224-111004246 TATGAAGGTGAAGGCAGATTTGG + Intergenic
1106529067 13:30570924-30570946 TATGAAAGTGAAAGCACATTAGG - Intronic
1107102058 13:36604225-36604247 AAGGAGAGTGAAGGTATCTCAGG - Intergenic
1107505090 13:41025971-41025993 TAGGACAGTGAAGGTATTTTTGG - Intronic
1107706525 13:43112632-43112654 TATGAAAATCAAGGTAACATAGG - Exonic
1108022489 13:46142601-46142623 TATGAAAGTGAGGGGTTCTAAGG - Intronic
1109867066 13:68278912-68278934 TTTGTAAGTAAATGTATCTTAGG - Intergenic
1109984990 13:69968511-69968533 TATGAAATTGAAGGTATTATGGG + Intronic
1110025066 13:70526960-70526982 TATGCAAGTGAAGACATTTTGGG + Intergenic
1110583828 13:77163978-77164000 TAAGAAAGAGAAGATAGCTTAGG - Intronic
1110867801 13:80417082-80417104 CATGAAAGTGAGAGAATCTTGGG - Intergenic
1111786188 13:92789718-92789740 AATGAAACTGAAGGTGTCTTAGG + Intronic
1112181258 13:97083382-97083404 TATTAAAGTGTAGGTGACTTGGG - Intergenic
1114293781 14:21311186-21311208 TTAGAAAGTGAAGGCAGCTTTGG + Intronic
1115072527 14:29341917-29341939 TATGAAAGTAAAGGATTCTATGG + Intergenic
1115373972 14:32652429-32652451 TAAGAAAGTGAAGGAAAATTGGG - Intronic
1116657634 14:47673052-47673074 GGAGAAAGTGAAGGTTTCTTGGG + Intronic
1117034475 14:51713898-51713920 TATGAAATTGAGGGTTTTTTAGG + Intronic
1117551475 14:56841132-56841154 TTTTAAAGGGAAGATATCTTTGG + Intergenic
1120102424 14:80460835-80460857 GATTAAAATGAAGGTATCTTGGG - Intergenic
1120256154 14:82122012-82122034 AATGTAAGTGAAGCCATCTTAGG + Intergenic
1121370214 14:93350327-93350349 TATGAATGTGAATATATTTTTGG + Intronic
1123835406 15:24185983-24186005 TTTGAAAGTAAAGTTGTCTTTGG - Intergenic
1126307158 15:47272989-47273011 TAGGAAATTGAGGGGATCTTGGG - Intronic
1126408935 15:48351860-48351882 TATCAAAATGATGATATCTTTGG + Intergenic
1130070528 15:80643346-80643368 TGTAAAAGTGAAGGGATGTTGGG - Intergenic
1130114654 15:80996219-80996241 TATGACAATGAAGGAATCTGGGG + Intergenic
1131009470 15:89004968-89004990 TGTTAAATTGAAGGTATCTGTGG + Intergenic
1131049800 15:89339558-89339580 TATGATACTGGAGGTATCTATGG + Intergenic
1131761255 15:95624900-95624922 AAGTCAAGTGAAGGTATCTTAGG - Intergenic
1131958258 15:97761361-97761383 TATGAAGGTAAAGATGTCTTTGG + Intergenic
1134141975 16:11728121-11728143 TAGGAAAGTTAAGGAATTTTTGG - Intronic
1134234359 16:12453830-12453852 GATGGCAGGGAAGGTATCTTTGG + Intronic
1135432989 16:22402549-22402571 TATAAAAGTAAAGCTATATTAGG - Intronic
1138019235 16:53462380-53462402 GAAGAAAATTAAGGTATCTTAGG + Intronic
1138201822 16:55094346-55094368 AATGTGAGTGAAGGCATCTTGGG + Intergenic
1139619556 16:68126548-68126570 TATGAAACTGAAGGTAGCCGAGG + Exonic
1140588035 16:76317879-76317901 TCTGAATGTGAAGGTATCAGTGG + Intronic
1144593110 17:16541525-16541547 TGTTAAAGAAAAGGTATCTTAGG + Intergenic
1148812174 17:50300423-50300445 TAGGGAACTGAAGGTCTCTTTGG + Intergenic
1148845714 17:50528714-50528736 CATGGAAGTGAAGGTACCTGTGG + Exonic
1149313548 17:55419312-55419334 TATGTGTGTGTAGGTATCTTGGG + Intronic
1150521534 17:65871801-65871823 TCTGACACTGAAGATATCTTGGG - Intronic
1150824656 17:68463872-68463894 AAAGAAATTGAAGGTGTCTTGGG + Intergenic
1151925541 17:77193543-77193565 TAAAAAAGTGAGTGTATCTTGGG + Exonic
1153541372 18:6159437-6159459 TATGAAACTGATGGAATCCTAGG - Intronic
1153552926 18:6281360-6281382 TAGGATAGTGAAGGCTTCTTTGG - Intronic
1153683138 18:7519772-7519794 AATAAAAGTGAAGATATTTTTGG + Intergenic
1153752368 18:8245896-8245918 TTTGAAAGTGAATGTATCTGTGG + Intronic
1156134757 18:34024349-34024371 TATGAAAGAGAAGTTTTCTAAGG - Intronic
1156429474 18:37056519-37056541 GGAGAAAATGAAGGTATCTTTGG - Intronic
1157986392 18:52442980-52443002 AAAGAAAGTTAAGGAATCTTGGG - Intronic
1159540964 18:69775342-69775364 TATTAAAGTTAATGTATATTAGG - Intronic
1163258185 19:16170483-16170505 TATGAAAGTGAAGGTATCTTTGG - Intronic
1165126767 19:33603598-33603620 GATGAAGTTGAAGGAATCTTTGG + Intergenic
1167170422 19:47827469-47827491 TATGAGAGTGAAGGCATTTGGGG - Intronic
925721956 2:6838165-6838187 TATGTTAGTGAAGGTGTCCTAGG + Intergenic
928448583 2:31356321-31356343 TTAGAAAGTGAATATATCTTTGG - Intronic
928855567 2:35799134-35799156 TAAGAAAGTGACGGTAATTTGGG + Intergenic
929283518 2:40109564-40109586 TCTGAAAGTGAACTTATCATAGG - Intronic
930437146 2:51359947-51359969 AATAAAAGTGAAAGCATCTTTGG - Intergenic
930573249 2:53113129-53113151 TATGAAAGGGAAAGTATCGGGGG - Intergenic
930627641 2:53716374-53716396 TATGAAAGTGCAGGAATAGTAGG + Intronic
938051528 2:128176886-128176908 TATTAAAGTGAAGGTGAGTTTGG + Exonic
938660256 2:133479550-133479572 TATGCAAGTCAGGGTATATTAGG - Intronic
939995501 2:148915722-148915744 GATGGAAGTGCAGGTTTCTTTGG + Intronic
940820485 2:158350269-158350291 TATCAAAGTGAATTTCTCTTTGG - Intronic
941139720 2:161764365-161764387 AATGAAAGTGGAGGTTTATTGGG + Intronic
942091292 2:172493879-172493901 AATGAAAGTGAGGTTCTCTTGGG + Intronic
943230441 2:185244039-185244061 TATTAAAGTGAGAGTATTTTAGG + Intergenic
944216298 2:197259562-197259584 TTTGAAAGTGAAGTTTTCTCAGG - Intronic
944567635 2:201006705-201006727 TATGAATGTGCCAGTATCTTTGG + Intronic
946748840 2:222872438-222872460 AAAGAAAGTAAAAGTATCTTAGG + Intronic
948024720 2:234767833-234767855 TATGAAAGTTGAGGTTACTTGGG + Intergenic
948552570 2:238784060-238784082 TATGAAAGTTAAGGCACCATGGG - Intergenic
1170362686 20:15564164-15564186 TGTGAAAGTGAAGATAACTGGGG + Intronic
1173555203 20:43961008-43961030 TTTGAAGGTGATGGTGTCTTGGG + Intronic
1173760049 20:45551853-45551875 TCTGAAAGTGATGATATATTTGG - Intronic
1175213056 20:57373665-57373687 TTTAAAGGTGAAGTTATCTTTGG - Exonic
1175917432 20:62433255-62433277 TATGAAAATGAGGGTACCTGTGG + Intergenic
1177089795 21:16753607-16753629 TATGCGAGTGAAGCTGTCTTGGG - Intergenic
1177623717 21:23631256-23631278 TATGAAAGTTAGAGAATCTTAGG - Intergenic
1178472767 21:32908693-32908715 AAGGACAGTGAAGGTTTCTTGGG + Intergenic
1178888643 21:36501841-36501863 GATAAAAGTGAATGTATTTTAGG + Intronic
1179171688 21:38977795-38977817 AATGAAAGTGAATGTTTCTATGG + Intergenic
1182131822 22:27859566-27859588 TATTAAAGTGAAAGTAACATGGG - Intronic
1182683731 22:32104066-32104088 AATGAAGTTGAAGGTCTCTTAGG - Intronic
1182954566 22:34410148-34410170 TGAGACAGTGAAGGAATCTTCGG - Intergenic
1184349829 22:43936289-43936311 CATGAATGTGAGGTTATCTTGGG + Intronic
952648990 3:35699870-35699892 TCTGAAAGTGATGTTTTCTTTGG - Intronic
955860208 3:63321469-63321491 TATGAAAGTCAAGTTATATGTGG + Intronic
959831344 3:110866279-110866301 TCTGAAAGGCAAGGTATCTAGGG - Intergenic
959993039 3:112649628-112649650 TATGAGAGAGGAGGTATCCTAGG - Intergenic
960058082 3:113290283-113290305 TAGGAATATGAAGGAATCTTAGG + Exonic
960083430 3:113565577-113565599 CAGGAAAGTGAATGTAACTTTGG - Intronic
962029690 3:131586787-131586809 TATGAAAGTGTGTGTATCTGAGG + Intronic
963284327 3:143418330-143418352 TAAGAAAGTTAATGTATCTGTGG + Intronic
963467953 3:145705979-145706001 AATGAATGTGAAAGTATCATAGG - Intergenic
963785794 3:149533146-149533168 TAGGAAACTGAAGGTTTGTTTGG - Intronic
964498086 3:157316794-157316816 AATGAAAGGGAAGATATCTTTGG - Intronic
965213586 3:165829610-165829632 TATGAAATTGAATTTGTCTTTGG - Exonic
965561668 3:170067654-170067676 TGTAAAAGTGAAGTTATTTTGGG - Intronic
966310913 3:178592791-178592813 TTTTAAAGTGAAGGTTTCTATGG + Intronic
966561944 3:181331136-181331158 AATGATAATGAAGGTAACTTTGG - Intergenic
968197070 3:196715298-196715320 GTTGAAAGTGGAAGTATCTTAGG + Intronic
970880279 4:20920520-20920542 TATGAAATTTAAGGTAACTGGGG + Intronic
971841652 4:31860307-31860329 TTTAAAATAGAAGGTATCTTAGG - Intergenic
972414751 4:38827544-38827566 CATGAAACTGGAGGTTTCTTTGG + Exonic
975092909 4:70424292-70424314 TTTCAAAGTGAAGGCACCTTAGG - Intergenic
977283561 4:95072291-95072313 TATGTAAGTGAGGGTGTCTTTGG - Intronic
977617311 4:99101001-99101023 TTTGGAAGTGAAGATTTCTTTGG + Intergenic
977739155 4:100456142-100456164 TCTGAAATTGTATGTATCTTAGG + Intronic
977860921 4:101958846-101958868 AATGACAGTGCAGGTATTTTGGG + Intronic
977882843 4:102225587-102225609 TATTAAAGTGGATGTATTTTTGG - Intergenic
979018667 4:115467231-115467253 TAAAAAAGTGAAAGTGTCTTAGG + Intergenic
980848176 4:138349256-138349278 CATAAAAGTGAAGCTATGTTAGG - Intergenic
981616711 4:146650317-146650339 AATTAAAGTGAGGGTCTCTTTGG + Intergenic
983045232 4:162979224-162979246 AAAGAAAATGAAGGTCTCTTTGG - Intergenic
983698848 4:170566643-170566665 TTTGAAAGTGAAGTTAAATTGGG + Intergenic
983715651 4:170778070-170778092 TATGCAAGTGTATGTGTCTTTGG - Intergenic
984288786 4:177766666-177766688 TATGAAAGGGAAGTTTTTTTGGG + Intronic
985038065 4:185861274-185861296 GCTGAAGGTGAAGGTTTCTTTGG + Intronic
987448229 5:18048420-18048442 TAAGAAAGAGGAGGTGTCTTAGG + Intergenic
989468558 5:41786822-41786844 TGTGTTAGTGAATGTATCTTAGG - Intronic
989812929 5:45698711-45698733 TATGAAATTTAAGTTTTCTTTGG + Intergenic
998023487 5:138791997-138792019 TATAAAACTGAGGGTCTCTTAGG + Intronic
999811274 5:155129777-155129799 TAGGAAAGGGAAGGTATTTCAGG - Intergenic
1000421385 5:161041932-161041954 CATGAGAGTGAAGCCATCTTGGG + Intergenic
1003329490 6:5118014-5118036 CATGAAAGTGTAGCTATCTTAGG - Intronic
1005144675 6:22675186-22675208 CATGAGAGTGCAGGTATCTTTGG - Intergenic
1005147601 6:22709157-22709179 TCTGCTGGTGAAGGTATCTTAGG + Intergenic
1005261548 6:24066470-24066492 TTTGAAAGTGAATATATCTTTGG - Intergenic
1006548860 6:34803627-34803649 TGTGAAAGTAAGGGTAGCTTAGG - Intronic
1008721208 6:54355628-54355650 TATGAAAATACATGTATCTTAGG + Intronic
1009498404 6:64379691-64379713 CATGAAAGTGAGGTGATCTTAGG + Intronic
1009680901 6:66891323-66891345 TATCAAAATGAAAGTATTTTCGG + Intergenic
1009733605 6:67644438-67644460 TCTAAAAGTGAAGAAATCTTAGG + Intergenic
1009970825 6:70624008-70624030 TATGTCAGTGAAGGTATTTCTGG + Intergenic
1010162829 6:72878294-72878316 TATGAAAGCAAAGGCATCTATGG - Intronic
1011342507 6:86332616-86332638 CATGAATGTGAAGTTATCATGGG + Intergenic
1013295459 6:108754576-108754598 TGTGAAAGAGCAGGTATCTGAGG - Intergenic
1015817551 6:137226093-137226115 AATGAAAACGCAGGTATCTTTGG + Intergenic
1016568835 6:145490617-145490639 TATGCAATGAAAGGTATCTTTGG - Intergenic
1016804183 6:148196415-148196437 TATGAAAGTGCAGGTAGCAGAGG + Intergenic
1016809670 6:148247712-148247734 TATGAAAGTAAATATTTCTTTGG + Intergenic
1019877871 7:3831049-3831071 TATGAAAGATAAGGAATTTTTGG + Intronic
1021002635 7:15352227-15352249 TTTGAAAGTGAAGTTAAATTTGG - Intronic
1022488935 7:30801721-30801743 CATGGAACTGAAGGTACCTTGGG - Intronic
1022833484 7:34091642-34091664 GTAGAAAGTGAAGGCATCTTAGG - Intronic
1023832143 7:44045489-44045511 GAGGAAAGTGAGGATATCTTGGG - Intronic
1024172369 7:46803257-46803279 AATGAAAGTAAAGGTATTTCTGG - Intergenic
1025745843 7:64241979-64242001 TATGACAGTCAACATATCTTGGG + Intronic
1028964910 7:96791478-96791500 CTTGAAAGTTAAGGTAACTTTGG + Intergenic
1031183491 7:118446452-118446474 TATGAGAGTGAGGATTTCTTTGG + Intergenic
1033845996 7:145432988-145433010 TTTGTAAGTGAAGGTGTGTTTGG - Intergenic
1035819863 8:2579753-2579775 TATGAGAGGGAAGGCATCCTAGG - Intergenic
1036063671 8:5354850-5354872 TCTGACAGTGAAGGAATCATTGG + Intergenic
1040752765 8:50730183-50730205 TATGAAAGTAAAACTATATTTGG + Intronic
1041056863 8:53994953-53994975 TTTAAAAGTGAATGTTTCTTTGG - Intronic
1041825053 8:62085860-62085882 TCTGAAAGTGAAGATATCATTGG + Intergenic
1043072969 8:75662557-75662579 TATGAAAGTGCAGGCAGCCTGGG + Intergenic
1043527130 8:81109640-81109662 TATGAAAGGAAATGCATCTTTGG - Intronic
1048070841 8:131019102-131019124 TATGAAATTGACGGTATTGTTGG + Intronic
1048113672 8:131496213-131496235 TATAAAAATTAAGGTTTCTTTGG - Intergenic
1048687344 8:136919131-136919153 AATGAAAGTGAAAGTGTTTTAGG + Intergenic
1050051227 9:1603683-1603705 TATGAAACTGGAGGTACATTTGG + Intergenic
1050935981 9:11395532-11395554 TATGGGAGTGCAGATATCTTTGG + Intergenic
1051723957 9:20069079-20069101 TATCAAAGTAAACGTATGTTGGG - Intergenic
1055184750 9:73437428-73437450 GTTGAAAGTGCAGTTATCTTAGG + Intergenic
1055574019 9:77645156-77645178 TGTGAAAGAGATGGTGTCTTTGG + Intronic
1056474675 9:86942392-86942414 AATGAAAGAAAAGGTATCTCTGG - Intergenic
1058003549 9:99892004-99892026 TATTAAAGTTAATGTATCTTTGG + Intergenic
1058241159 9:102562172-102562194 TATGAAAGTGAACATCTCATTGG + Intergenic
1059774848 9:117464708-117464730 TTTGAAAGTGGTGGTATTTTTGG + Intergenic
1061917918 9:133766061-133766083 TATGAAAGAGAAGGGATGTCAGG + Intronic
1187709698 X:22040821-22040843 TATGAAAGAGAATACATCTTAGG + Intronic
1188709837 X:33381854-33381876 TATAAAAGTGAAGGTATTTCAGG + Intergenic
1189405292 X:40716866-40716888 TATGGAAGTGAAGGTCACTATGG + Intronic
1191190964 X:57666804-57666826 TTTGAAAGTTCAGGGATCTTTGG + Intergenic
1192408019 X:70906900-70906922 TATGAATGTGAAGGTACCACAGG + Intronic
1193587515 X:83343546-83343568 TTTGAAAGTTAAGAAATCTTGGG + Intergenic
1194663465 X:96651785-96651807 TTTGAAAGTGATTGTATCCTGGG - Intergenic
1195751755 X:108166574-108166596 TATAAAAGTGATGGTAGATTTGG + Intronic
1196288348 X:113909311-113909333 GATGAAACTAAAGATATCTTTGG - Intergenic