ID: 1163258645

View in Genome Browser
Species Human (GRCh38)
Location 19:16173260-16173282
Sequence CTGTGTGAGTGTGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1881
Summary {0: 1, 1: 0, 2: 6, 3: 199, 4: 1675}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258645_1163258656 24 Left 1163258645 19:16173260-16173282 CCCTCCACCCCACACTCACACAG 0: 1
1: 0
2: 6
3: 199
4: 1675
Right 1163258656 19:16173307-16173329 AGCAGAACCAGGAACCCAGGCGG 0: 1
1: 2
2: 5
3: 42
4: 528
1163258645_1163258657 28 Left 1163258645 19:16173260-16173282 CCCTCCACCCCACACTCACACAG 0: 1
1: 0
2: 6
3: 199
4: 1675
Right 1163258657 19:16173311-16173333 GAACCAGGAACCCAGGCGGACGG 0: 1
1: 0
2: 1
3: 21
4: 230
1163258645_1163258653 13 Left 1163258645 19:16173260-16173282 CCCTCCACCCCACACTCACACAG 0: 1
1: 0
2: 6
3: 199
4: 1675
Right 1163258653 19:16173296-16173318 GCCACACACAGAGCAGAACCAGG 0: 1
1: 0
2: 2
3: 24
4: 330
1163258645_1163258655 21 Left 1163258645 19:16173260-16173282 CCCTCCACCCCACACTCACACAG 0: 1
1: 0
2: 6
3: 199
4: 1675
Right 1163258655 19:16173304-16173326 CAGAGCAGAACCAGGAACCCAGG 0: 1
1: 0
2: 2
3: 53
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258645 Original CRISPR CTGTGTGAGTGTGGGGTGGA GGG (reversed) Intronic
900024706 1:261000-261022 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900028315 1:350405-350427 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
900116462 1:1031091-1031113 GTGTGTGTGTGTGCGGTGCATGG + Intronic
900127009 1:1073195-1073217 CTATGTGAGGGTGGGGTGTGGGG + Intronic
900313436 1:2045806-2045828 CTCTGTGAGTGAAGGGTGCAGGG - Intergenic
900432373 1:2608414-2608436 ATGTGTGTGTGTGGTGTGGGGGG - Intronic
900436808 1:2634846-2634868 CTGTGTGGGTGTTGGGGGGATGG - Intergenic
900436848 1:2634991-2635013 CTATGTGGGTGTTGGGGGGATGG - Intergenic
900509507 1:3051848-3051870 GTGGGTGGGTGTTGGGTGGATGG - Intergenic
900548030 1:3239397-3239419 CTGGGAGACTGTGGGGTCGAGGG - Intronic
900738659 1:4316911-4316933 CAGTGTGAGTGGGTGGTGGCTGG + Intergenic
900844953 1:5090191-5090213 CAGTTTGAGTCTGCGGTGGAAGG - Intergenic
900996134 1:6124611-6124633 CTGTGTGAGCCGGGGGCGGATGG - Exonic
901166209 1:7223394-7223416 GTGTGTGAGTGTGTGATGGGAGG + Intronic
901179978 1:7335128-7335150 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
901293692 1:8144595-8144617 GTGTGTGTGTGTGAGATGGATGG + Intergenic
901527222 1:9831170-9831192 TTGTGTGTGTGTGTGGTGGTGGG + Intergenic
901831800 1:11897302-11897324 GTGTGTGTGTGTCGGGGGGAGGG - Intergenic
901927049 1:12572989-12573011 CTGGATGGGTGTGGGGTAGAGGG - Intronic
902091535 1:13907495-13907517 CTGTGTGTGTGTGTGTTGGGTGG + Intergenic
902091537 1:13907499-13907521 GTGTGTGTGTGTTGGGTGGGTGG + Intergenic
902272501 1:15314738-15314760 GTGTGTGAGTGTGGTGTGTGGGG + Intronic
902646395 1:17802437-17802459 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
902734436 1:18390824-18390846 TTGTGTGTGTGTGGGGGGGGGGG + Intergenic
902922452 1:19674835-19674857 ATGTGTGATTGTTGGCTGGAAGG + Intronic
902974688 1:20080336-20080358 CTTTGGGAGTGTGAGGTGGGTGG + Intronic
903184440 1:21621408-21621430 CTGTGTGTGTGTGCGGGTGAGGG - Intronic
903269102 1:22176729-22176751 TTGTGTGTGGGTGGGGTGGGGGG + Intergenic
903326327 1:22570888-22570910 CCGCGTGAGCGTGGTGTGGAAGG + Intronic
903537624 1:24077398-24077420 CTGAGAGAGTGTGGAGTGAAGGG - Intronic
903622456 1:24707809-24707831 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
903673307 1:25049297-25049319 GTGAGTGTGCGTGGGGTGGAGGG - Intergenic
903809820 1:26029081-26029103 GAGTGTGGGTGTGGGGTGCAGGG + Intronic
904115734 1:28160556-28160578 GTGTGTGTGTGGGGGGTGGCGGG - Intronic
904203162 1:28835015-28835037 ATGAGTGGGTGTGGGGTAGAGGG + Intronic
904568899 1:31445777-31445799 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
904680032 1:32222627-32222649 CCCTGTGAGTGTTGGCTGGAGGG + Exonic
904717916 1:32483145-32483167 CTTTGGGAGGCTGGGGTGGATGG + Intronic
904753311 1:32754270-32754292 GGGTGTGAGTGTGGGGGGGTCGG + Intronic
905233671 1:36530749-36530771 GTGTGTGTGTGTGGTGTGGTGGG + Intergenic
905263081 1:36732767-36732789 CAGTGAGGGAGTGGGGTGGAAGG + Intergenic
905343477 1:37295350-37295372 CTGTGAGAGTCTGGTGTGCATGG + Intergenic
905508427 1:38499185-38499207 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
905893066 1:41529058-41529080 GTGTGTGAGTGTGAGGGTGAGGG - Intronic
905893162 1:41529553-41529575 ATGTGTGAGGGTGGGGTGTGGGG - Intronic
906038116 1:42766012-42766034 CTGTGTGTGTGTGGGGGCGGGGG - Intronic
906134920 1:43491888-43491910 CTGAGTTTGTGGGGGGTGGAAGG + Intergenic
906143206 1:43545799-43545821 CTGTGTGTGTTTGTGTTGGAGGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
906323988 1:44832932-44832954 CTGTGTTGGTGTGGGGGAGAGGG + Intronic
906381618 1:45335900-45335922 TTGGGAGAGTCTGGGGTGGAAGG - Intronic
906382503 1:45341596-45341618 AGGTGTGGCTGTGGGGTGGAGGG + Intronic
906662294 1:47591382-47591404 GTGTGTGCCTGTGGGGTGAAGGG + Intergenic
906662301 1:47591413-47591435 GTGTGTGCCTGTGGGGTGAAGGG + Intergenic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
906914127 1:49989992-49990014 CTTAGTGAGTGAGGGGTGGAAGG + Intronic
907245774 1:53108193-53108215 CAGTGTGAGTGTGGGGCGGCAGG - Intronic
907268721 1:53277910-53277932 GTGAGTGGGTGTGGAGTGGATGG + Intronic
907423760 1:54365350-54365372 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
907637221 1:56147641-56147663 GTGTGTGTGGGTGGGGTGGAGGG + Intergenic
907663476 1:56414557-56414579 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
907756005 1:57311515-57311537 GTGTGTGTGTGTGTGGTGGTTGG - Intronic
907870278 1:58436898-58436920 CTGCTTGAGTGTGGGGATGAAGG - Intronic
907998334 1:59655424-59655446 CTGTGGTGGGGTGGGGTGGAGGG - Intronic
908075781 1:60516437-60516459 TTCTTTGAGGGTGGGGTGGAGGG + Intergenic
908285027 1:62587803-62587825 CTGTGTGGGGGTGTGGGGGAAGG + Intronic
908384357 1:63627056-63627078 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
908470983 1:64443726-64443748 GTGTGTGTGTGTCGGGTGGCGGG - Intergenic
908564636 1:65341781-65341803 GTGTGTGCCTGTGGGGTGGGTGG + Intronic
908860011 1:68473941-68473963 GCGTGTGTGTGTGGGGGGGAGGG - Intergenic
909084305 1:71153714-71153736 GTGTGTGTGTATGGGGTGGTTGG - Intergenic
909195507 1:72616828-72616850 CTGTGTGTGTGCGGGGGGGAGGG - Intergenic
909527147 1:76638070-76638092 CTTTGGGAGGGTGAGGTGGATGG - Intergenic
909616488 1:77615924-77615946 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
909636470 1:77822030-77822052 ATGTGTGTGTGTGGTGTGTAAGG - Intronic
909802730 1:79832892-79832914 TTGTGTGTGTGTGGGGGGGGGGG - Intergenic
910147105 1:84093305-84093327 CTGTGTGTGTGTGGTGAGGTAGG + Intronic
910227103 1:84947299-84947321 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
910229383 1:84970268-84970290 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910737675 1:90479469-90479491 TTGTGTGTGTGTGGATTGGAGGG - Intergenic
910818729 1:91321652-91321674 GTGTGTACGTGTGGGATGGAGGG - Intronic
911266427 1:95750086-95750108 CTGTGTGTGTGTGGTGGGGTGGG - Intergenic
911437901 1:97886393-97886415 CTCTATGAGTGGGGGCTGGATGG - Intronic
912159690 1:106966705-106966727 CTGTGTGAGTGTGGTAATGAAGG - Intergenic
912290652 1:108418865-108418887 TTGTGTGTGTGTGGGGGGGGTGG - Intronic
912330733 1:108818025-108818047 CTAGGTGAGTGAGGGGTGCAGGG + Intronic
912453963 1:109785598-109785620 CTGGGTGGCTGTGGGGTTGAGGG + Intergenic
912602289 1:110949087-110949109 GTGTGTGTGTGTGGGGTGGGCGG + Intronic
912645019 1:111384213-111384235 CTGGTTGAGTATGGGGTGAATGG - Intergenic
912669415 1:111610523-111610545 GTGTGTGTGTGTTGGGTGGAGGG - Intronic
912679788 1:111721808-111721830 GTGTGTGTGTGTGTGGTGGCGGG + Intronic
912709587 1:111940846-111940868 GGGTGTGTATGTGGGGTGGAAGG - Intronic
912803953 1:112741391-112741413 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
912823754 1:112887250-112887272 CTGTGGGAGCCTGGGGTGGGTGG - Intergenic
912907068 1:113718524-113718546 CTCTGTGAGGGTAGTGTGGAAGG - Intronic
912949678 1:114111977-114111999 CTGGGGGTGTCTGGGGTGGAAGG + Intronic
912965232 1:114231312-114231334 GTGTGTGTGTGTGGGGTGTCGGG - Intergenic
913370115 1:118089341-118089363 GTGTGTGTGTGTGTGGTGGCAGG + Intronic
913578333 1:120199770-120199792 CTTTGGGAGGGTGGGGTGGTAGG - Intergenic
913629839 1:120698581-120698603 CTTTGGGAGGGTGGGGTGGTAGG + Intergenic
914447889 1:147765511-147765533 CTGTAGGGGTGTGGAGTGGATGG + Intronic
914560256 1:148811210-148811232 CTTTGGGAGGGTGGGGTGGTAGG - Intronic
914612577 1:149319005-149319027 CTTTGGGAGGGTGGGGTGGTAGG + Intergenic
914916855 1:151824293-151824315 CTGTGTGTGTGTGGTGGGGGTGG + Intronic
914925095 1:151878283-151878305 CTATGTGTGTGTGGAGTGGAGGG - Intronic
915127772 1:153678246-153678268 GTGTTTGGGTGTGGGGTGGAAGG - Intergenic
915159356 1:153906091-153906113 GTGTGTGTGTGTGGGGTGCGGGG - Intronic
915265591 1:154714568-154714590 GTGTGTGTGTGTGGTGTGTATGG + Intronic
915443124 1:155958901-155958923 CAGTGTGGGTGGGGGGTGGGGGG + Intronic
915546644 1:156602640-156602662 CTGTGGGAGTGAGGGGAGGGCGG + Intergenic
915593218 1:156882251-156882273 GTGTGTGTGTGTGGGGTGATGGG + Intergenic
915597240 1:156902591-156902613 GTGTGTGGGTGTGGGGTGTGGGG + Intronic
915729002 1:158039575-158039597 ATGAGTAAGTGTGGGGTGGGAGG - Intronic
915944578 1:160140513-160140535 TTGTGTGTGTGGGGGGAGGAGGG + Intronic
916286802 1:163115137-163115159 CTGTTGGAGGGTGGGGTTGAGGG + Intronic
916311694 1:163405766-163405788 CTGTGTGAAAGTGGGATGGTGGG - Intergenic
916435812 1:164776921-164776943 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
916652206 1:166842836-166842858 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
916990824 1:170242922-170242944 GTGTGTGTGTGTGGGGAGGGGGG + Intergenic
917250814 1:173058668-173058690 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
917309415 1:173663048-173663070 GTGTGTGTGTGTGTGTTGGAAGG - Intronic
917430456 1:174962198-174962220 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
917463665 1:175255155-175255177 ATGTGTGTGTGTGGGGTGGGTGG + Intergenic
917696064 1:177525330-177525352 TTCTGTGATTGTGGGGTAGAAGG - Intergenic
917999858 1:180482858-180482880 GTGTGTGAGTGTGTGGGGCAAGG + Intronic
918422882 1:184381940-184381962 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
918473284 1:184897304-184897326 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
918639682 1:186824794-186824816 CAGTGTGTGTGTGGATTGGAGGG + Intergenic
918746201 1:188203457-188203479 TTGTGTGTATGTGGGGTGGGTGG + Intergenic
918766012 1:188484474-188484496 TTGTGTGTGTGTGGGGGGGGGGG - Intergenic
918771190 1:188562527-188562549 CAGTGTGGGTGTGAGGAGGAGGG - Intergenic
919078274 1:192838579-192838601 TTTTGTGGGTGTGGGGTGTAGGG + Intergenic
919165112 1:193882114-193882136 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
919640479 1:200040397-200040419 CTGAGTGAGTTGGGGGTGGGAGG + Intronic
919723653 1:200867000-200867022 GTGTGTGTGAGTGGGGTGGGGGG - Intergenic
919790115 1:201285213-201285235 GTGTGTGTGTGTGTGGTGGAAGG - Intronic
919920146 1:202162486-202162508 CTGGGTGGATGTGGGGTAGAGGG + Intergenic
919924230 1:202184178-202184200 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
919974543 1:202602199-202602221 GAGTGTGAGGGTGGGGTGGGAGG + Intronic
920189115 1:204181065-204181087 GTGTGTGTGTGTGGTGTGTAGGG + Intergenic
920299491 1:204979596-204979618 CAGTGTGAGTTTGGGGTGCGGGG - Intronic
920367192 1:205454409-205454431 CTTTGTGTGTGTGGGGTGCGTGG + Intronic
920542085 1:206786448-206786470 CTGTGTGAGTGAGGGTTGGCTGG + Intergenic
920558811 1:206924101-206924123 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
920558841 1:206924680-206924702 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
920709103 1:208278075-208278097 CTGGGTCAGAGTGGGGTGAATGG + Intergenic
920933732 1:210412069-210412091 CTGTGTGCTTTTGTGGTGGAAGG + Intronic
921253207 1:213316719-213316741 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
921348771 1:214214164-214214186 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
921441825 1:215196678-215196700 GTGTGTGAGTGTGGTGTGTGTGG + Intronic
921918950 1:220644452-220644474 TTGTGTGTGTGTGGGGGGGGGGG - Intronic
921973176 1:221173334-221173356 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
922130463 1:222772228-222772250 CTGTGTAAGTGTTGTGTGGGGGG + Intergenic
922282965 1:224143396-224143418 CTGAGTGAGTGTGGGTGTGAGGG + Intronic
922434803 1:225593389-225593411 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
922585630 1:226733097-226733119 CTGTGTGAGTGGGGTGAGCAAGG + Intronic
923144442 1:231188096-231188118 CAGTGTGATGGAGGGGTGGAAGG - Intronic
923145825 1:231196954-231196976 CTGTGTAGGGATGGGGTGGACGG + Intronic
923869090 1:237971560-237971582 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
924081283 1:240400797-240400819 TTGTGTGTGTGTGTGGTGGTCGG - Intronic
924098411 1:240578539-240578561 CTTTGTGAGTCTGAGGTGGATGG + Intronic
924124390 1:240834907-240834929 GTGTGTGTGTGTGGAGTGTAAGG - Intronic
924218012 1:241845391-241845413 ATGTGTGTGTGTGGTGGGGAAGG + Intergenic
924261504 1:242236113-242236135 CTGTGTCCTTGTGTGGTGGAAGG - Intronic
924305254 1:242681140-242681162 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
924631911 1:245748827-245748849 GTGTGTGAGTGTGGTATGCACGG - Intergenic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
924748974 1:246867892-246867914 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
924784513 1:247183132-247183154 CTGTCTGAGTGTGGGGTGGGAGG - Intergenic
924956532 1:248933600-248933622 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1062768820 10:84098-84120 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1062796355 10:347651-347673 CTGGGTGAGTGTGGGGTTTCCGG - Intronic
1062796382 10:347790-347812 CTGGGTGAGTGTGGGGTTTCCGG - Intronic
1062796405 10:347919-347941 CTGGGTGAGTGTGGGGTTTCCGG - Intronic
1062866528 10:860116-860138 ATGTGTGGGGGTGGGGGGGAGGG + Intronic
1063039242 10:2319984-2320006 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1063234606 10:4099950-4099972 CTTTGGGAGGGTGAGGTGGAGGG - Intergenic
1063397787 10:5707681-5707703 ATGTGTGTGTGTGGGGTTGGGGG - Intronic
1063518862 10:6722840-6722862 GTGTGTGTGTGTGTGGTTGAGGG + Intergenic
1063752363 10:8965009-8965031 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1063958218 10:11284668-11284690 ATGTGTGAGTGTGTGGATGATGG + Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064162268 10:12956773-12956795 GTGTGTGAGTTTGTGGTGGTGGG - Intronic
1064223922 10:13465889-13465911 GTGTGTGTGTGTGTGGTGGCAGG + Intronic
1064451344 10:15444848-15444870 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1064795201 10:19004302-19004324 TTCTTTGAGTGGGGGGTGGAAGG - Intergenic
1065191292 10:23211467-23211489 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1065513923 10:26506239-26506261 CCGTGTGTGTGTGGGGGGGGGGG + Intronic
1065519398 10:26556783-26556805 ATGTCTGAGTGGGGGGTGGGTGG + Intronic
1066360726 10:34727807-34727829 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1066360735 10:34727871-34727893 GTGTGTGTGTGTGTGGCGGAGGG - Intronic
1066549685 10:36543017-36543039 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1067013058 10:42732429-42732451 CTGTGTGTGTGGTGTGTGGAGGG - Intergenic
1067158139 10:43799867-43799889 CTGGGTTAGCGTGGGGTGGGAGG + Intergenic
1067211252 10:44261781-44261803 CTGGGTGAGTGAGGTGTGCAAGG - Intergenic
1067228331 10:44389713-44389735 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1067310773 10:45111641-45111663 CTGTGTGTGTGGTGTGTGGAGGG + Intergenic
1067390703 10:45860503-45860525 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1067616976 10:47763781-47763803 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1067711567 10:48655245-48655267 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1067716281 10:48693249-48693271 GTCTGACAGTGTGGGGTGGATGG + Intronic
1067878057 10:50021507-50021529 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1067878059 10:50021509-50021531 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1067932362 10:50575604-50575626 CTTTGTGTGTGGGGGGAGGAGGG - Intronic
1068124838 10:52826880-52826902 GTGTGTGTGTTTGGGGTGGGGGG + Intergenic
1068155426 10:53191337-53191359 CAGTGCGTGTGTGGGATGGAAGG - Intergenic
1068270344 10:54715708-54715730 ATGTCTGAGTGTGACGTGGAGGG - Intronic
1068608514 10:59032736-59032758 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1068918834 10:62462188-62462210 CTGTGTGTGTGTGTGTGGGAGGG - Intronic
1069083335 10:64111779-64111801 GTGTGTGAGTGTAGTGTGTATGG + Intergenic
1069086753 10:64149318-64149340 ATATGTGTGTGTGGGGTTGAGGG + Intergenic
1069244637 10:66188566-66188588 CTGTGTGTGTGTGGGGGGAGGGG + Intronic
1069455548 10:68551201-68551223 CTTTGGGAGTCTGAGGTGGAAGG + Intergenic
1069465910 10:68638797-68638819 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1069558508 10:69413525-69413547 CCGTGAGAGGGTGGGGTGCAGGG + Intronic
1069580819 10:69565328-69565350 CAGTGTGTGTGTGGGATGGGGGG + Intergenic
1069953170 10:72033585-72033607 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1070002629 10:72392186-72392208 CTGTGTGTGTGTGGCGGGGTCGG + Intronic
1070069282 10:73070936-73070958 CTGTGGGAGGCTGAGGTGGAAGG + Intronic
1070137890 10:73710738-73710760 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1070534124 10:77362356-77362378 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1070655427 10:78267838-78267860 CTGTGTGAGTGGAGTGGGGAAGG + Intergenic
1070776339 10:79112036-79112058 CTGAGTGATTGTGGTGTGGCTGG + Intronic
1070937443 10:80312037-80312059 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1071234642 10:83631246-83631268 GTGTGTGTGTGTAGGGTGGGAGG + Intergenic
1071473770 10:86007295-86007317 CAGTGTCAGTGGGGGGTGGGAGG - Intronic
1071583238 10:86793108-86793130 CCATGTGTGTGTGGGGTGGCGGG - Intronic
1071623192 10:87141785-87141807 CTTTGTGAGTCTGAGGTGGGTGG + Intronic
1072004235 10:91227763-91227785 ATGTGTGAGTGTTAGGTGGTAGG - Intronic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1072622160 10:97087272-97087294 TTGTGACAGTGTTGGGTGGAAGG + Intronic
1072752194 10:97989271-97989293 CTGTGTGTGCGTTGGGTGGGGGG - Intronic
1072766022 10:98095879-98095901 GTTTGTGAGTGAGGTGTGGAAGG + Intergenic
1073042203 10:100615279-100615301 GTGTGTGGGTTTGGGGAGGAGGG + Intergenic
1073051225 10:100668618-100668640 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1073090010 10:100928036-100928058 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1073146186 10:101283714-101283736 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1073296967 10:102446434-102446456 CTTTGGGAGTTTGAGGTGGATGG + Intergenic
1073451153 10:103610141-103610163 CAGAGTGAGTGAGGGGTGGGAGG + Intronic
1073982364 10:109169076-109169098 ATGTGTGTGTGTGTGGTGGTGGG - Intergenic
1074252460 10:111765173-111765195 ATGTGTGTGTGGGGGGTGGGGGG - Intergenic
1074373800 10:112922383-112922405 CTTTGGGAGGGTGGGGTGGGAGG + Intergenic
1074422201 10:113319164-113319186 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1074454618 10:113586464-113586486 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1074518570 10:114196185-114196207 CTTTGTGAGTCTGAGGTGGGAGG - Intronic
1074724875 10:116297633-116297655 CTGTGTGTTTGTGGAGAGGACGG + Intergenic
1075010571 10:118866231-118866253 CTGTATGTGTGTGGCGGGGATGG + Intergenic
1075242683 10:120792901-120792923 CAGTGTGTGTGTGGGGGGGGGGG - Intergenic
1075242778 10:120793266-120793288 CAGTGTGTGTGTGGGGGGGAGGG - Intergenic
1075618061 10:123905784-123905806 CTGGGTGAGGGTGGGGTGGGAGG - Intronic
1075745896 10:124727319-124727341 CTGAGTGATTGTGGGGGGGGGGG + Intronic
1075834240 10:125439977-125439999 GTGTGTGTGTGTGGGGGGGTGGG + Intergenic
1076122614 10:127948311-127948333 CTGTGTGTGTGTAGGGTTAAGGG - Intronic
1076189312 10:128471431-128471453 GTGTGTGTGTGTGGGGGGGATGG - Intergenic
1076207018 10:128611668-128611690 CTGTTGGAGGGTGGGGTCGATGG - Intergenic
1076570285 10:131428217-131428239 CTGTCTGAGTGTGGCAGGGATGG + Intergenic
1076598586 10:131642062-131642084 GACTGTGAGTGTGGGGGGGAAGG - Intergenic
1076896691 10:133316680-133316702 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1076962332 10:133774487-133774509 CTGGGTCAGTGTGGGGCGGTGGG - Intergenic
1077034413 11:487904-487926 CAGGGTGAGCGTGGGGTGGGTGG - Intronic
1077039343 11:511845-511867 CTGTGTGTGTGGGGGGTGGCTGG - Intergenic
1077315000 11:1915625-1915647 CTGTGTGTGTGTGTTGTGGGGGG + Intergenic
1077320685 11:1939646-1939668 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1077372097 11:2187231-2187253 CTGTGTGTGTGTGTGGTGTGTGG - Intergenic
1077417928 11:2433516-2433538 CTGTGTGAGTGTGCTGTGTGTGG + Intergenic
1077466630 11:2736613-2736635 CTGTGTAACTGGGGGGTGGGAGG - Intronic
1077481816 11:2818566-2818588 CTGTGTGCGTGTGGGGATGGGGG - Intronic
1077537657 11:3132131-3132153 GTGTCTGAGTGTGAGGTGAATGG - Intronic
1077614424 11:3664842-3664864 GTGTGTGGGAATGGGGTGGACGG + Intergenic
1078350126 11:10586154-10586176 CTGTGTGTGTGTGTGGAGGGTGG + Intronic
1078401785 11:11034804-11034826 GTGTGTGTTTGTGGGGTGGGGGG - Intergenic
1078421717 11:11218092-11218114 CTGTGTGTATGTGTGGTGCAGGG - Intergenic
1078488917 11:11751256-11751278 CTGTATGTGTGTGGGGTGGGTGG - Intergenic
1078611121 11:12820330-12820352 CTGTGGGTGGGTGGGGTGGGAGG - Intronic
1078946473 11:16073608-16073630 CTGTTTTTTTGTGGGGTGGAGGG - Intronic
1079084056 11:17432763-17432785 CTGTGTGCGGGTGGGGTAGCTGG + Intronic
1079242976 11:18733626-18733648 CTGTGAGGGTCTGGGGTGGTGGG + Exonic
1079327081 11:19503208-19503230 CTGTGTATGTGTGGGGGGCAAGG - Intronic
1079333633 11:19552883-19552905 GTGAGTGTGTGTGGGGGGGAAGG + Intronic
1079391159 11:20023272-20023294 GTGTGTGAGTGGGGGTGGGAGGG + Intronic
1079581166 11:22066567-22066589 CTGTGTCACTTTTGGGTGGATGG - Intergenic
1079676147 11:23229359-23229381 GTGTGTGGGTGTGGAGTGGGTGG - Intergenic
1080028555 11:27637190-27637212 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1080305309 11:30828705-30828727 GTGTGTGTGTATGTGGTGGAGGG - Intergenic
1080395294 11:31884553-31884575 CTGTGTGTCTGTGGAGAGGAGGG + Intronic
1080641399 11:34160605-34160627 CTGTGTGTGTGTGTGTTGGGTGG + Intronic
1080641403 11:34160609-34160631 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080641437 11:34160727-34160749 GTGTGTGTGTGTTGGGTGGGGGG + Intronic
1080791366 11:35525386-35525408 CTGTGTGTGTTTGGGGTGAGGGG - Intronic
1080925056 11:36747609-36747631 TTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1081049697 11:38322969-38322991 GTGTGTGTGTGTGTGGTGGGAGG + Intergenic
1081155417 11:39683943-39683965 TTGTGTGTGTTGGGGGTGGAAGG - Intergenic
1081205192 11:40266952-40266974 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1081306300 11:41516104-41516126 CTTTGTGAGTCTGAGGTGGGTGG - Intergenic
1081408164 11:42722372-42722394 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1081429010 11:42955663-42955685 GTGTGTGTGTGTGGCATGGAGGG + Intergenic
1081532008 11:43968335-43968357 CTGTGTGGGTGTGGGGTCGTGGG - Intergenic
1081690715 11:45075953-45075975 GTGTGTGTTTGTGGGGTGGGGGG + Intergenic
1081789551 11:45773395-45773417 CTGTGTAAGTATGAGGTGGGTGG - Intergenic
1082071599 11:47943945-47943967 ATGTGTGTGTGTGGGGGGGGGGG + Intergenic
1082822275 11:57552206-57552228 TTGTGTGTGTGTGTGGTGGAGGG - Exonic
1082902686 11:58272792-58272814 CTGTGTGTCTGTGGAGAGGACGG + Intergenic
1082943952 11:58738915-58738937 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1083188778 11:61034799-61034821 CTGGGTGGGGGTGGGGTAGAGGG - Intergenic
1083230171 11:61312376-61312398 CTGTGTCAGAGTTGGCTGGAGGG + Intronic
1083268041 11:61556030-61556052 GTGTGTGTGTGTGGGGAGGGGGG + Intronic
1083296442 11:61717987-61718009 GAGTGTGTGTGTTGGGTGGATGG + Intronic
1083419316 11:62544490-62544512 CTGTGGGAATGTGGGTTAGAGGG - Intronic
1084035126 11:66504963-66504985 CTGTGTGTGTGTCGGGGGGGTGG - Intronic
1084107816 11:66991666-66991688 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1084215406 11:67644725-67644747 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1084288110 11:68144966-68144988 GTGTGTGTGTGTGGTGTGTATGG + Intergenic
1084611921 11:70208739-70208761 GAGTGTGAGTGTGGCGTGGAGGG - Intergenic
1085195384 11:74668644-74668666 CTGGGTGAGTAAGGGGTGGGTGG + Intronic
1085353153 11:75813963-75813985 TTGTGTGTGTGTGGGAAGGAGGG + Intergenic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085448274 11:76615539-76615561 GTGTGTGTGTGTTGGGGGGATGG - Intergenic
1085500661 11:77019797-77019819 CTGTGTGTGTGTTGGGGGTATGG + Intronic
1085622783 11:78050035-78050057 GTGTTTGAGTGAGGGATGGATGG + Intronic
1085948750 11:81304255-81304277 CTGTTGGAGGGTGGGGTGGGGGG - Intergenic
1086000101 11:81973224-81973246 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1086189975 11:84067549-84067571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1086317928 11:85612822-85612844 CTGTGAGAGTGTGTGGTAGTAGG - Intronic
1086905973 11:92418425-92418447 CTGTGTGTGTGTGGGGGGGTGGG - Intronic
1086961436 11:92982938-92982960 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1086976939 11:93142939-93142961 CTGTTTGGGGGTGGGGTGGGAGG + Intergenic
1087242649 11:95797165-95797187 CTGTGTGTGTGTGTGTTGGGAGG - Intronic
1087642116 11:100766231-100766253 GTGTGTGTGTGTGGTGTGGGGGG + Intronic
1087957506 11:104306835-104306857 CTTTTTGTGTGTGGGGTGGGGGG + Intergenic
1088000765 11:104877362-104877384 GTGTGTGTGTGTGGGGGGGGTGG + Intergenic
1088200719 11:107330637-107330659 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1088263273 11:107965300-107965322 GTGTGTGTATGTTGGGTGGAGGG + Intergenic
1088326758 11:108608843-108608865 CTGTGTGAGAGAGAGGGGGAGGG + Intergenic
1088832577 11:113550038-113550060 TTGTGTGTGTGTGGGGTCGGCGG - Intergenic
1089318930 11:117611977-117611999 CTGTTTGTGTGTTGGGGGGATGG - Intronic
1089391509 11:118105078-118105100 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1089665487 11:120015339-120015361 CTGTGTGTGTGTGTTGTGGGGGG - Intergenic
1089736288 11:120552306-120552328 ATGTGTGGGGGTGGGGTGGGGGG - Intronic
1089913415 11:122127007-122127029 GTATGGGAGTGTGGGGTAGAAGG + Intergenic
1090003891 11:122983863-122983885 CTGTGTGAGGCTGGAGTGTAGGG - Intergenic
1090181492 11:124704128-124704150 CTGTGTGAGTGGAGGCTGGGTGG - Intergenic
1090225729 11:125071126-125071148 TGGTGTGTGTGTGGGGTGGGGGG + Intronic
1090373982 11:126276303-126276325 GTGTGTGTGTGTGGGGTGTGGGG + Intronic
1090397460 11:126428525-126428547 ATGTGTGTGTGTGCGGGGGAGGG + Intronic
1090427161 11:126615955-126615977 GTGTGTGTGTGTGGGGTGCGTGG + Intronic
1091332968 11:134744881-134744903 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1091395612 12:152692-152714 CTGTGTGTGTGTGGGGTGGCAGG - Intronic
1091398055 12:166017-166039 CTGTGGGAGTGTGGTGCGGTGGG - Intronic
1091427914 12:407482-407504 ATGTGTGAGTCTAGAGTGGAGGG + Intronic
1091432339 12:446950-446972 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1091560025 12:1605209-1605231 GTGTGAGAGTGTGTGGGGGAGGG + Intronic
1091658043 12:2360168-2360190 GTGTGTGTGTGTGGGGTGGGGGG - Intronic
1091799513 12:3316089-3316111 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1092056454 12:5511988-5512010 CTGTGTGCATGGGGGGAGGAGGG + Intronic
1092178899 12:6431206-6431228 CTTTGAGAGGCTGGGGTGGAAGG + Intergenic
1092192846 12:6533326-6533348 GTTTGTGAGTGTGGGATGGGAGG - Intergenic
1092272829 12:7037154-7037176 CTGTGTGTGTGTGTGTTGGCGGG + Intronic
1092282582 12:7108977-7108999 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1092599564 12:10044677-10044699 CTGTGTGGATGTGGGCTGAAGGG - Intronic
1092923886 12:13256838-13256860 CTGGGTGAGGTTGTGGTGGAGGG + Intergenic
1093508219 12:19894459-19894481 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1093702321 12:22235885-22235907 GTGTGTGTGTGTGTGGTGAAGGG - Intronic
1093741480 12:22693752-22693774 CTGTGTGTGTGTGTGTTGGGGGG + Intergenic
1093776948 12:23086756-23086778 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1093810324 12:23485053-23485075 TTGTGTTAGTGTTGGGGGGATGG - Intergenic
1093842323 12:23919118-23919140 ATGTGTGTGTTTGGGGTGGTGGG + Intronic
1094078820 12:26509990-26510012 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094429413 12:30350317-30350339 CTGTGTGGGTGGGGGGGGGGCGG + Intergenic
1094794844 12:33959847-33959869 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095082696 12:38025766-38025788 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1095093383 12:38128251-38128273 TTTTGTGAATGTGGGGTGGGGGG - Intergenic
1095130977 12:38541933-38541955 GTGTGTATGTGTTGGGTGGATGG + Intergenic
1095393731 12:41739999-41740021 GTGTGTGTGTGTGGGGTGTGGGG - Intergenic
1095577635 12:43758656-43758678 GTGTGTGTGTGTGGGGGGGGGGG - Exonic
1095921651 12:47537774-47537796 GGGTGTGAGTGTGGGGGTGAGGG + Intergenic
1095958724 12:47820445-47820467 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1095962644 12:47845069-47845091 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1095980734 12:47973274-47973296 CTGTGAGAGGGTGGGATGAATGG + Exonic
1096176924 12:49527828-49527850 GGGGGTGAGTGTGGGGTGGAAGG - Intergenic
1096216586 12:49801161-49801183 CTGTGTGTGTGTATGGGGGAGGG - Intronic
1096370558 12:51065701-51065723 CTTTGGGAGGCTGGGGTGGAAGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096491575 12:52015612-52015634 CTGTGTGTGTGGAGGGTGGGGGG - Exonic
1096505347 12:52088988-52089010 CTGGATGAGTGAGGGGTGAATGG - Intergenic
1096525332 12:52206971-52206993 GTGTGTGTGTGTAGGGTGGATGG + Intergenic
1096647546 12:53047060-53047082 CTTTGTGAGTGTGGGTTCGCGGG + Intronic
1096985328 12:55752360-55752382 CTTTGTGTGTGTGTGGTGGGTGG + Exonic
1097555192 12:61127793-61127815 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1097708496 12:62893625-62893647 ATGTGTGTGTGCGGGGGGGAGGG + Intronic
1097933972 12:65224508-65224530 CTGTGTGTGTGTGTGGTAGGGGG - Intronic
1097981620 12:65742105-65742127 CAGTGTGAGTGTGAGGGGGCCGG - Intergenic
1098205208 12:68101919-68101941 TTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1098302533 12:69068902-69068924 CTGTATGAGTGTTGGGGGGTGGG - Intergenic
1098579777 12:72085619-72085641 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1098597801 12:72294356-72294378 CTGTGTGTGTGTGTGGTGGGGGG + Intronic
1099152889 12:79137337-79137359 CTTTGGGAGGTTGGGGTGGATGG - Intronic
1099206351 12:79732397-79732419 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1099542627 12:83932130-83932152 ATGTGTGTGTGTGGGGGGGGGGG + Intergenic
1099653919 12:85465277-85465299 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1099755014 12:86834605-86834627 GTGTGTGTGTGTGTGGTGGTTGG - Intronic
1100344181 12:93711028-93711050 GGGTGGGAGGGTGGGGTGGAGGG - Intronic
1100445124 12:94652820-94652842 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1101026523 12:100612750-100612772 ATGTGTGGGGGTGGGGTGGTGGG - Intronic
1101302623 12:103496771-103496793 ATGTGGGTGTGTGGGGTGGTGGG - Intergenic
1101332580 12:103769107-103769129 GTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1101510386 12:105387745-105387767 GTGTGTGTGTGTGTGGTGGTAGG + Intronic
1101660686 12:106762845-106762867 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1101876064 12:108597661-108597683 CTGTGTGAGGGTGATGTGGACGG - Intronic
1102686460 12:114728607-114728629 CTTTGGGAGGCTGGGGTGGACGG + Intergenic
1102863899 12:116359321-116359343 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1102921361 12:116794020-116794042 CTTTGAGAGTGTGAGGTGGGAGG + Intronic
1103015219 12:117489152-117489174 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1103143742 12:118575543-118575565 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
1103293647 12:119867679-119867701 GTGTGTGAGTTTGGGGGGAAGGG - Intronic
1103418609 12:120761832-120761854 CTCTGTGAGGGTGGAGGGGAAGG - Intergenic
1103797096 12:123510678-123510700 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797109 12:123510843-123510865 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797123 12:123511041-123511063 CTGTGTGTGTGTGGTGTGTGGGG + Intronic
1103797134 12:123511180-123511202 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797208 12:123512167-123512189 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797264 12:123512928-123512950 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103797278 12:123513114-123513136 CTGTGTGTGTGTGGTGTGTGAGG + Intronic
1103902376 12:124310062-124310084 ATGTGGGAGGCTGGGGTGGAAGG + Intronic
1103912165 12:124358426-124358448 CTGTGTGTGTGTGTTGTGGCGGG + Intronic
1103954455 12:124568422-124568444 GTGTGTGTGTGTGGGGGGGGCGG - Intergenic
1104360562 12:128129151-128129173 GTGTGTGTGTGTGGGGGGGGCGG - Intergenic
1104568074 12:129903185-129903207 GTGTGGGAGTGTGTGGAGGATGG - Intronic
1104606960 12:130196927-130196949 CTGGGTGAGAGTGGGGGAGATGG + Intergenic
1104610211 12:130221404-130221426 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1104878857 12:132055433-132055455 GTGTGTGTGTGTGTGGTGTAGGG + Intronic
1104878861 12:132055462-132055484 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104878867 12:132055502-132055524 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104908251 12:132226994-132227016 ATGTATGTGTGTGGGGGGGATGG - Intronic
1105039695 12:132953156-132953178 GTGAGTGAGAGTGGGGTTGATGG - Intronic
1105437999 13:20393126-20393148 CTGTGTGTGTGTGGTGTGGCTGG - Intergenic
1105532068 13:21229305-21229327 GTGGGTGAGTGTGGGGGGGGTGG - Intergenic
1105604511 13:21915761-21915783 CTGTGTGAGGGCGGAGTGGATGG - Intergenic
1105638420 13:22238513-22238535 GTGTGTGAGTGTGTGGTTGGGGG + Intergenic
1105700709 13:22934390-22934412 GTGTGTGTGTGTGTGGTGCATGG - Intergenic
1105706755 13:22971971-22971993 CCGTGTGAGTCTGGGTGGGACGG - Intergenic
1106012378 13:25837416-25837438 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
1106192023 13:27462014-27462036 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1106227935 13:27799049-27799071 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1106395091 13:29371977-29371999 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1106408047 13:29490995-29491017 GTGTGTGTGTGTGGTGTGGGAGG + Intronic
1106408058 13:29491037-29491059 GTGTGTGTGTGTGTGGTGGGAGG + Intronic
1106801677 13:33262639-33262661 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1106993960 13:35459008-35459030 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1107282172 13:38749576-38749598 TTGTGTGTGTGTTGGGTGGGAGG + Intronic
1107757646 13:43642205-43642227 ATGTGTGATTGTGTGTTGGAGGG - Intronic
1107985005 13:45767971-45767993 CTGTGTGTGTGTGGTGGGGGCGG + Intergenic
1108099417 13:46937894-46937916 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1108251430 13:48571659-48571681 CTGTTTGTGTGTGGGGTGCTGGG + Intergenic
1108399380 13:50023894-50023916 CTTTGGGAGGGTGAGGTGGAAGG - Intergenic
1108625552 13:52225058-52225080 CTTTGTGAGGCTGAGGTGGAAGG + Intergenic
1108660511 13:52581360-52581382 CTTTGTGAGGCTGAGGTGGAAGG - Intergenic
1108965699 13:56297836-56297858 GTGTGTGTGTGTGTGGTGGAAGG - Intergenic
1109592614 13:64505933-64505955 CTGTGTGTGTGTGTGGAGAAAGG - Intergenic
1109657752 13:65416351-65416373 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1109838664 13:67893102-67893124 CTGTCAGGGTGTGGGGTGCAAGG + Intergenic
1110064416 13:71085875-71085897 CAGTGTGAGTGTGATGTAGATGG + Intergenic
1110131368 13:72015736-72015758 CTTTGGGAGGCTGGGGTGGATGG - Intergenic
1110426754 13:75375764-75375786 ATGTGTGTGTGTGGGGGGGGTGG - Intronic
1110705180 13:78596410-78596432 CTGAGTGAGTGAGGGGAGGGCGG + Intergenic
1110839695 13:80127808-80127830 CTGAGTGACTGAGGTGTGGAGGG + Intergenic
1111090260 13:83437276-83437298 GTGTGTGTATGTGGGGTGTAGGG - Intergenic
1111463154 13:88572533-88572555 CTTTGGGAGGGTGAGGTGGAAGG + Intergenic
1111541439 13:89672284-89672306 CAGAGTGGGAGTGGGGTGGATGG - Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1111786319 13:92791411-92791433 GTGTGTGAGTGTGTGGGGGGGGG + Intronic
1112063049 13:95761346-95761368 CTGTGTGAGTGTTGTTTGTAGGG + Intronic
1112212255 13:97389457-97389479 CTTTGGGAGTCTGAGGTGGAAGG + Intronic
1112641689 13:101282649-101282671 CTCTGTGTGTGTGGGGTGGGGGG - Intronic
1112657788 13:101470676-101470698 GTGTGTGTGGGAGGGGTGGAGGG + Intronic
1112726494 13:102310685-102310707 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1113120722 13:106921334-106921356 GTGTGTGTGTGTGGCGGGGAGGG + Intergenic
1113245861 13:108394619-108394641 CTATGTGTGTGTGGGGGGGGAGG - Intergenic
1113389592 13:109882662-109882684 TTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1113454547 13:110438803-110438825 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1113619448 13:111703016-111703038 CTGGGTGAGTGTGGGGCGGTGGG + Intergenic
1113624977 13:111788277-111788299 CTGGGTGAGTGTGGGGCGGTGGG + Intergenic
1113755960 13:112811155-112811177 GTGTGTGTGTGTGTGTTGGAAGG - Intronic
1113795680 13:113056337-113056359 CTGTGTGGGTGTGGAGTGTTTGG + Intronic
1113901375 13:113800181-113800203 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1113902336 13:113804067-113804089 CTGTGTGAAGGTGGGGAGGGAGG + Intronic
1113934038 13:113984077-113984099 ATGGGTGAGTGATGGGTGGAGGG - Intronic
1113934090 13:113984312-113984334 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934117 13:113984447-113984469 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934124 13:113984474-113984496 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934138 13:113984528-113984550 GTGGGTGAGTGATGGGTGGATGG - Intronic
1113934391 13:113986075-113986097 ATGGGTGAGTGATGGGTGGAGGG - Intronic
1113934430 13:113986259-113986281 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934450 13:113986367-113986389 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934457 13:113986394-113986416 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934539 13:113986771-113986793 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934735 13:113988065-113988087 ATGGGTGAGTGATGGGTGGAGGG - Intronic
1113934774 13:113988249-113988271 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934794 13:113988357-113988379 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934801 13:113988384-113988406 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934815 13:113988438-113988460 GTGGGTGAGTGATGGGTGGATGG - Intronic
1113934922 13:113988926-113988948 CAGGGTGAGTGATGGGTGGATGG - Intronic
1113934940 13:113989001-113989023 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113934992 13:113989260-113989282 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113935016 13:113989367-113989389 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113935035 13:113989444-113989466 ATGGGTGAGTGACGGGTGGATGG - Intronic
1113935046 13:113989497-113989519 ATGGGTGAGTGATGGGTGGATGG - Intronic
1113935087 13:113989677-113989699 ATGGGTGAGTGACGGGTGGATGG - Intronic
1114328083 14:21609690-21609712 CTTTGGGAGTCTGAGGTGGAAGG + Intergenic
1114559622 14:23580654-23580676 CTGGGTGAGTGTGGGCTTGGCGG + Intergenic
1114885289 14:26842399-26842421 CTGCCTGTGTGTGGGGTGGTAGG - Intergenic
1115039671 14:28908527-28908549 CTTTGGGAGGCTGGGGTGGACGG + Intergenic
1115278138 14:31631232-31631254 CTGTGTGTGTGTGGGTTGGGGGG + Intronic
1115387813 14:32818324-32818346 GTGTGTGTGTGTGGTGGGGAAGG - Intronic
1115400014 14:32946323-32946345 GTGTGTGTGTGTTGGGGGGATGG - Intronic
1115671534 14:35617621-35617643 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
1115856657 14:37636934-37636956 CTGTGTGATATTGGGGTGGAGGG + Intronic
1115888726 14:38003713-38003735 ATGTGTGTGTGTGTGGTGGGGGG + Intronic
1116025957 14:39515063-39515085 CTGTTTGAGTATGGGGTTGGGGG + Intergenic
1116283195 14:42936818-42936840 GTGTGTGAGTGTGGGGGTGTGGG + Intergenic
1116443288 14:44979373-44979395 CTGTGTCCTTATGGGGTGGAAGG + Intronic
1117244516 14:53870888-53870910 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1117534773 14:56693435-56693457 CTTTGGGAGTCTGAGGTGGACGG - Intronic
1117659988 14:57993295-57993317 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
1118034428 14:61851057-61851079 CTGTTGGAGGGTGGGGTGGGAGG - Intergenic
1118047998 14:61993257-61993279 CTGTGGGGGTGTGGGGGGCAAGG + Intergenic
1118247259 14:64123359-64123381 CAATGTGAGTATGTGGTGGAAGG - Intronic
1118384328 14:65243247-65243269 GTGTGTGAGAGTGAGGTGGGTGG + Intergenic
1118568694 14:67171649-67171671 CTGTGTTTGTGAGGGGGGGATGG - Intronic
1118764149 14:68898948-68898970 GTGTGTGTGTGTGGAGTGAAGGG - Intronic
1118846416 14:69550830-69550852 CTGTGTGAGTGTGAGGTAGGTGG + Intergenic
1118857926 14:69638462-69638484 TTGTGTGTGTGTGGGATTGAAGG + Intronic
1119274993 14:73347194-73347216 ACATGTGAGTGTGGGGTGGGGGG - Intronic
1119641165 14:76316013-76316035 CTCTGAGAATGTGGGGTGGAGGG - Intronic
1119716715 14:76864608-76864630 CTTTGGGAGGCTGGGGTGGAAGG + Intronic
1119914296 14:78382910-78382932 GAGTGTGTGTGTGGGGAGGAGGG + Intronic
1120145891 14:80978088-80978110 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1120368501 14:83602389-83602411 CTGTTTGAGTGTGGGTTGTGGGG - Intergenic
1121029015 14:90641947-90641969 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1121127271 14:91416633-91416655 CGGGGTGTGTGTGGGGTGGGGGG - Intronic
1121250081 14:92492947-92492969 GTGTGTGTGTTTGGGGTAGAGGG - Intronic
1121341189 14:93106170-93106192 CTGTGGGGTGGTGGGGTGGATGG - Intronic
1121569766 14:94938873-94938895 GTGTGTGTGTGTGTGGTTGATGG + Intergenic
1121620649 14:95345846-95345868 GTGTGTGTGTGTGGGGCGGGGGG + Intergenic
1121674177 14:95739194-95739216 GTGTGTGAGTGTGTGGTTGAGGG + Intergenic
1121746195 14:96295720-96295742 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1121843393 14:97153017-97153039 GTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1121843681 14:97155246-97155268 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
1122137682 14:99644452-99644474 CTGTATGTGTGTGGGGGGGTGGG + Intergenic
1122309710 14:100786754-100786776 GTGTGTGTGTGTGGGGCGGGGGG - Intergenic
1122631051 14:103107923-103107945 CTGTGGGGCTGGGGGGTGGAGGG + Intronic
1122879472 14:104683605-104683627 CTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1122967866 14:105139612-105139634 ATGACTGAGTATGGGGTGGAGGG + Intergenic
1123055798 14:105569129-105569151 GTGTGTGAGTGTGTGGTATATGG - Intergenic
1123055815 14:105569293-105569315 TTGTGTGAGTGTGTGGTATATGG - Intergenic
1123055859 14:105569684-105569706 TTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123055879 14:105569870-105569892 GTGTGTGAGTGTGTGGTATATGG - Intergenic
1123055882 14:105569896-105569918 GTGTGTGAGTGTGTGGTATATGG - Intergenic
1123055889 14:105569962-105569984 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123055937 14:105570557-105570579 ATGTGTGAATGTGTGGTGTATGG - Intergenic
1123080201 14:105688903-105688925 GAGTGTGAGTGTGTGGTGTATGG - Intergenic
1123080270 14:105689655-105689677 CTGTGTGAGAGTGTGGTATATGG - Intergenic
1123080276 14:105689705-105689727 TTGTGTGAATGTGTGGTGTATGG - Intergenic
1123080303 14:105690004-105690026 GTGTGTGAGTGTGTGGTATATGG - Intergenic
1123080352 14:105690490-105690512 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123080375 14:105690719-105690741 GTGTGTGAATGTGTGGTGTATGG - Intergenic
1123080386 14:105690829-105690851 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123432116 15:20226790-20226812 CTGGGTGTGTGAGGGGTGGAGGG - Intergenic
1123482033 15:20640998-20641020 ATGTGTGTGTGTGGGGGGGGGGG - Intergenic
1124884228 15:33669832-33669854 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1124921481 15:34030859-34030881 CTTTGGGAGGGTGAGGTGGAAGG - Intronic
1125252212 15:37717958-37717980 CTGTTAGGGGGTGGGGTGGAAGG - Intergenic
1125419327 15:39488319-39488341 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1125641654 15:41236185-41236207 CTTTGAAAGTCTGGGGTGGAAGG - Intronic
1125756164 15:42066451-42066473 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1125787959 15:42339299-42339321 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1125866831 15:43059306-43059328 CTGTGAGAGGCTGAGGTGGAAGG - Intronic
1127275736 15:57442208-57442230 CAGTGTGAGAGTAGGATGGATGG - Intronic
1127283014 15:57508190-57508212 TTGTGTGTGTGTGGGGCGGGGGG - Intronic
1127640715 15:60913364-60913386 CTGTAGGAGGCTGGGGTGGAGGG - Intronic
1127682226 15:61309054-61309076 GTGTGAGTGTGTGGGGTGGAGGG + Intergenic
1127774419 15:62254145-62254167 CTGGGAGAGTGTGGGGCTGATGG + Intergenic
1127808363 15:62541596-62541618 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1127817664 15:62625895-62625917 CTGTGTGAGTGTGCAATAGAGGG + Intronic
1128080910 15:64856403-64856425 CTATGTGGATGTGGGGTGGAGGG + Intronic
1128132748 15:65240296-65240318 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1128220312 15:65964227-65964249 CTTTGGAAGTGGGGGGTGGAGGG + Intronic
1128224486 15:65992437-65992459 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1128224488 15:65992439-65992461 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1128390486 15:67179522-67179544 CTGGGTGTGTGTGGAGTGCAGGG + Intronic
1128514662 15:68334855-68334877 CTGGGTGAGTGTGGGCAGGCAGG + Intronic
1128707266 15:69845711-69845733 CTGTGTATGTGTGGGGAGGGAGG + Intergenic
1128715967 15:69908255-69908277 ATGAGTGAGTGGGGGGTGGGTGG - Intergenic
1128717652 15:69920386-69920408 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
1128859634 15:71055842-71055864 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1128860907 15:71071163-71071185 GTGTGTGTGTGTGTGTTGGAAGG + Intergenic
1128875708 15:71199439-71199461 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1128995458 15:72291293-72291315 CTCTGGGAGCGTGGGGTAGAGGG + Intronic
1129356342 15:74994552-74994574 TGGTGTGGGTGGGGGGTGGAGGG + Intronic
1129430043 15:75493515-75493537 CTTTGGGAGGCTGGGGTGGACGG + Intronic
1130186043 15:81683515-81683537 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1130254072 15:82317747-82317769 CTATGTGAGTGTGGGGCCCAGGG + Intergenic
1130371058 15:83285238-83285260 GTGTGTGCGTGTGCGGTGGGGGG - Intergenic
1130415995 15:83695248-83695270 GTGTGTGTGTGTGTGGTGGTGGG + Intronic
1130600900 15:85272224-85272246 CTATGTGAGTGTGGGGCCCAGGG - Intergenic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1130890005 15:88125684-88125706 CTGTGGCAGGGTGGGGTGGTGGG - Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131107780 15:89746496-89746518 CTGTGTGTGTGTGTGGAGGCGGG - Intergenic
1131107831 15:89746780-89746802 GTGTGTGTGTGTGGGGAGGTAGG - Intergenic
1131313006 15:91307724-91307746 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1131518839 15:93098373-93098395 GTGTGTGAGTGTGGGGAAGGAGG + Intergenic
1131665573 15:94568007-94568029 CTTTTTGTGTGTGTGGTGGAGGG + Intergenic
1131686792 15:94776943-94776965 TTGTGTGTGTATGGGGGGGAGGG - Intergenic
1131791867 15:95973898-95973920 GTGTGTGTGTGTGGTGTGTATGG + Intergenic
1131808479 15:96147894-96147916 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1131864739 15:96695618-96695640 CTGTGTGAGTGGGTGTGGGAGGG + Intergenic
1131953143 15:97703599-97703621 GTGTGTGTGTGTGGGGGGGGAGG - Intergenic
1131957745 15:97755612-97755634 GTGTGTGTGTGTTGGGTGGGTGG - Intergenic
1131998244 15:98154269-98154291 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1132166954 15:99602718-99602740 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1132269016 15:100506466-100506488 GTGTGTGTGTGTGGGGCGGCGGG - Intronic
1132425786 15:101715575-101715597 ATATGTGTGCGTGGGGTGGATGG - Intronic
1132457678 16:33122-33144 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1133017814 16:2952698-2952720 CTGCGTGAGTGAGGGGCTGAGGG - Intergenic
1133049604 16:3109747-3109769 CTGGGACAGTGTGGGGTGAAAGG + Intergenic
1133314250 16:4872448-4872470 TTGTGTGTGTGGGGGGTGGGTGG + Intronic
1133321857 16:4919061-4919083 CGGTGTGTGTGTGGGGAGGGGGG - Intronic
1133521152 16:6558707-6558729 CTGTGTGAGAGTGGGACGGACGG - Intronic
1133589288 16:7227287-7227309 CTGTGTGTGTGTGTGGGGGTGGG - Intronic
1133612867 16:7449718-7449740 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1133715119 16:8440429-8440451 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1133782067 16:8947350-8947372 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
1133978590 16:10617576-10617598 CTGTGAGAGTGTAGGGGTGAAGG - Intergenic
1133981100 16:10633861-10633883 ATGTGTTGGGGTGGGGTGGAGGG - Intronic
1134107429 16:11494319-11494341 CTGAGTGGGGGTGGGGTGAAGGG - Intronic
1134793881 16:17016507-17016529 GTGTGTGTGTGTGGTGTGGAGGG + Intergenic
1134890864 16:17840816-17840838 CTGCTTGTGAGTGGGGTGGATGG + Intergenic
1135158562 16:20073982-20074004 CGGAGTGTGTGTGGGGTGGGAGG + Intergenic
1135182762 16:20290012-20290034 CTTGGGGAGTGCGGGGTGGAAGG - Intergenic
1135477893 16:22793906-22793928 CTGTTTGTGTGTGTGGTGGGGGG - Intergenic
1135566582 16:23515945-23515967 CTGTGGGAGGCTGAGGTGGAAGG - Intronic
1135605774 16:23823279-23823301 CTTTGTGAGGCTGAGGTGGACGG + Intergenic
1135763098 16:25153432-25153454 CTGTGTGAGAGAGAGGTGAAGGG + Intronic
1135840616 16:25873151-25873173 GTGTGTGGGTGATGGGTGGATGG - Intronic
1135933174 16:26756868-26756890 GTATGTGTGTGTGGGGTGGATGG + Intergenic
1135964535 16:27024866-27024888 CTGTGTGTGTGGGGGGGGGGGGG - Intergenic
1135971808 16:27077636-27077658 CTTTGGGAGTCTGAGGTGGATGG - Intergenic
1136115114 16:28089508-28089530 GTGTGGGAGTGTGGTGTGTATGG - Intergenic
1136224989 16:28854182-28854204 CTGTGGGAGGCTGGGGTGGGAGG + Intronic
1136284788 16:29234380-29234402 CTGTGTGAGTGTCGCTTGGTTGG - Intergenic
1136574216 16:31113715-31113737 CTTTGGGAGGCTGGGGTGGAAGG - Intergenic
1136637836 16:31537211-31537233 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1136653488 16:31693812-31693834 GTGTGTGTGTGTGGTGTGTATGG - Intergenic
1136692786 16:32047784-32047806 GTGTGTGTGTGTGGGGGGGGTGG + Intergenic
1136793282 16:32991009-32991031 GTGTGTGTGTGTGGGGGGGGTGG + Intergenic
1136852522 16:33624349-33624371 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1136924546 16:34359751-34359773 CTTTGTGAGTGTGGTGGGCATGG + Intergenic
1136980027 16:35052055-35052077 CTTTGTGAGTGTGGTGGGCATGG - Intergenic
1137401191 16:48155720-48155742 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1137601761 16:49760909-49760931 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1137642669 16:50046471-50046493 CGGCGTGAATGTGGGGTGGAAGG + Intergenic
1137995952 16:53213010-53213032 CTGAATGAGTGTGGGCTTGAAGG - Intronic
1138234929 16:55374093-55374115 GTGTGTAAGTGTCGGGTGGGAGG - Intergenic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138466176 16:57192812-57192834 CAGTGGGAGTGAGGGGTGGGAGG - Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1138691746 16:58775276-58775298 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1138900254 16:61260490-61260512 ATGTGTGTGTGTGTGGTGAATGG + Intergenic
1139250647 16:65492226-65492248 GTGTGTGTGTGTGGTGTGGCAGG - Intergenic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1139780607 16:69348450-69348472 CTTTGTGTGTGCGGGGGGGAGGG + Intronic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140669569 16:77263929-77263951 CTGTGTGGGGGTGGGGAGGAGGG - Intronic
1140738654 16:77922160-77922182 CTGTGTGAGTTTGGGATGGCGGG + Intronic
1140741410 16:77944910-77944932 CTGTGTGTGTGTGTGGCGGGGGG - Intronic
1141118845 16:81335135-81335157 CTGTGTGACTATGGGGTGGGGGG + Intronic
1141169030 16:81679722-81679744 CTCTGTGACTCTAGGGTGGAGGG + Intronic
1141229800 16:82155499-82155521 GTGTGTATGTATGGGGTGGAGGG - Intronic
1141234040 16:82198998-82199020 CTGTGTGTGTGGGGAGAGGAGGG - Intergenic
1141305589 16:82860377-82860399 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1141436320 16:84001787-84001809 ATGTGTGAGTCAGGGGTGGCAGG - Intronic
1141533188 16:84660863-84660885 CTTTGTGAGGGTGAGGTGGGTGG - Intronic
1141820722 16:86443818-86443840 CTGTGTGCGTGTGGGTGTGAGGG - Intergenic
1141882335 16:86868265-86868287 TTGTGTGAGGGTGAGGTGGGCGG + Intergenic
1142070055 16:88086992-88087014 GCGGGTGAGTGTGGGGTGGGTGG - Intronic
1142378090 16:89717112-89717134 CGGGGTCAGTGGGGGGTGGAAGG - Intronic
1203114122 16_KI270728v1_random:1472817-1472839 CTGGGTGTGTGAGGGGTGGAGGG + Intergenic
1142518367 17:448020-448042 TTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1142679061 17:1534973-1534995 CTGCGTGTGTGTGCGGTGGGGGG - Intronic
1142679076 17:1535050-1535072 CTGCGTGTGTGTGCGGTGGGGGG - Intronic
1142716131 17:1747923-1747945 CTGTCTGGGTGTGGTGGGGATGG + Intronic
1142723878 17:1797603-1797625 CTGCTGCAGTGTGGGGTGGAAGG + Intronic
1143060426 17:4196033-4196055 CTGTGTGGGTGGGGGGTGGTGGG - Intronic
1143077572 17:4357497-4357519 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1143334577 17:6162695-6162717 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1143353797 17:6309381-6309403 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1143469233 17:7161395-7161417 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1143583235 17:7838438-7838460 TTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1143594565 17:7906581-7906603 CTGTGTGAGCCTGGGGCAGACGG + Exonic
1143841680 17:9737220-9737242 GTGTGTGTGTGGGGGGTGGGGGG + Intergenic
1143952969 17:10648159-10648181 CTGTGTGGTTGTAGGGAGGAGGG - Intronic
1143997454 17:11019601-11019623 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1144009051 17:11127915-11127937 ATGTGTGTGTGTGTGGTGGTTGG + Intergenic
1144117072 17:12106250-12106272 CTGTGTCTGTTTTGGGTGGAGGG + Intronic
1144209971 17:13005902-13005924 CAGTGTGAGTGTGGGGGGTAAGG - Exonic
1144447846 17:15347501-15347523 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447858 17:15347544-15347566 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144447870 17:15347587-15347609 GGGTGTGAGTGAGGAGTGGAAGG + Intergenic
1144628556 17:16857964-16857986 CTGTGTGAATCTGGGCTGCAGGG - Intergenic
1144654737 17:17028418-17028440 CTGTGTGAATCTGGGCTGCAGGG + Intergenic
1145004574 17:19330111-19330133 CTGTGTGCCTCTGGGATGGAAGG + Intronic
1145016318 17:19400669-19400691 TTGTGTGTGTGTGGGGTAGTGGG + Intergenic
1145123425 17:20280983-20281005 CTGCGTTAGTGTGAGGAGGAAGG + Intronic
1145160145 17:20568535-20568557 CTGTGTGAATCTGGGCTGCAGGG - Intergenic
1145264742 17:21374356-21374378 CTGTGTGTGTGTGTGTGGGAAGG + Intergenic
1145864208 17:28229525-28229547 CTGTGTGGGTGGGGAGTGGGAGG + Intergenic
1145963538 17:28901453-28901475 CTGCGTGGGGGTGGGGTGGCGGG - Intronic
1146053460 17:29569252-29569274 CCGTGTGTGTGTGGTGGGGAGGG - Intronic
1146157921 17:30539544-30539566 ATGTGTGTGTGTGTGGTGGGGGG - Intergenic
1146575237 17:33985282-33985304 ATGTGTGAGTGGGGGGAGGTTGG - Intronic
1146778751 17:35647388-35647410 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
1147063457 17:37902215-37902237 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1147212789 17:38881753-38881775 GTGTGTGAGTTTGGTGTGCAGGG + Intronic
1147360582 17:39927363-39927385 CAGAGGGAGTGGGGGGTGGAGGG - Intronic
1147764611 17:42825086-42825108 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1148333831 17:46828444-46828466 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1148478396 17:47944223-47944245 GTGTGTGTGTGTGTTGTGGAGGG + Intronic
1148695964 17:49558437-49558459 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1148739269 17:49883044-49883066 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1148949483 17:51297952-51297974 GTGTGTGTGTTGGGGGTGGAGGG - Intergenic
1149112123 17:53046541-53046563 CTGTGTGTGTGTGTGGAGCAGGG + Intergenic
1149289359 17:55201185-55201207 CAGTGTGACTGTGGAGGGGAAGG - Intergenic
1149399640 17:56282300-56282322 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1149431571 17:56598327-56598349 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1149515202 17:57275888-57275910 GTGTTTGAGTTTGGAGTGGAGGG + Intronic
1149547042 17:57511388-57511410 CTGGGTAAGTGTGGGGTGGGTGG - Intronic
1149600669 17:57891150-57891172 CTGTATGAGTGTGGAGTTGAGGG - Intronic
1149727285 17:58909260-58909282 CTGTCTCAGTGTGGGGTTGGCGG - Intronic
1149737218 17:59007152-59007174 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1150006018 17:61469514-61469536 CTGGGTAAGTGTGGGGATGAAGG - Intronic
1150250538 17:63702008-63702030 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1150824617 17:68463602-68463624 GTTTGGGAGTGTGGGGTGTAGGG + Intergenic
1151147921 17:72058391-72058413 CTCTGGGAGGGTGGGGGGGATGG - Intergenic
1151208933 17:72529287-72529309 CTGTGTGTGTGTAGGGGGGTGGG - Intergenic
1151442553 17:74140866-74140888 CTTTGAGAGTCTGAGGTGGATGG + Intergenic
1151599409 17:75097171-75097193 TTGTGTGTGTCTGCGGTGGAGGG - Intronic
1151828134 17:76535031-76535053 CTGTCTGAGTGTGAGGAGGAAGG + Intronic
1151898091 17:76993957-76993979 CTGGGGGAGGGTGGGGTGGGAGG - Intergenic
1151917640 17:77130208-77130230 AGGTGCCAGTGTGGGGTGGAGGG + Intronic
1152053389 17:78000621-78000643 TTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1152077731 17:78169262-78169284 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1152235951 17:79138905-79138927 CTGTGTGCGTGTGCGGGTGAGGG - Intronic
1152262228 17:79273414-79273436 GTGTTTTAGGGTGGGGTGGATGG + Intronic
1152339216 17:79715179-79715201 GTGTGTGTGTGTGGCGGGGAGGG - Intergenic
1152449201 17:80365740-80365762 CTGTGTGGGTGTGGGGAAAAGGG - Intronic
1152450088 17:80373212-80373234 GTGTGTGGGTTTGGGGTGTATGG - Intronic
1152744486 17:82032495-82032517 CCGTGTGAGTGTGGCATGGGGGG + Intronic
1152903063 17:82956453-82956475 CTGCATGGGTGTGGGGGGGATGG - Intronic
1152926624 17:83090420-83090442 GTGTGTGTGTGTGGGGCGGGGGG - Intronic
1152926640 17:83090462-83090484 GTGTGTGTGTGTGGGGCGGGGGG - Intronic
1152951447 17:83236153-83236175 CTGCGTCAGTGTGGGGCGGTGGG - Intergenic
1152961706 18:83931-83953 ATGTGTGAGTGTGTGGTGGGTGG - Intergenic
1153296999 18:3556205-3556227 CTGTGTGTGTGTCGGGGGAAGGG - Intronic
1153488993 18:5629406-5629428 GTGTGTGTGTGTGGTGTGTAAGG - Intronic
1153779269 18:8479652-8479674 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1153980896 18:10309535-10309557 CTGTGTAATTGAGGGGAGGAGGG + Intergenic
1154092589 18:11379077-11379099 GTGTCCGAGGGTGGGGTGGAGGG - Intergenic
1154314308 18:13292132-13292154 CTGTCTGGCTGTGGGGTGGATGG + Intronic
1154492929 18:14934901-14934923 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
1155079156 18:22390374-22390396 CTGTTAGGGGGTGGGGTGGAGGG + Intergenic
1155167104 18:23240349-23240371 CTGTGTGTGTGTAGGGGGAAGGG - Intronic
1155187143 18:23397083-23397105 TTGTGTGTGTGTGGGGCGGCGGG + Intronic
1155572213 18:27207517-27207539 GTGTGTGTGTGTGGGGGGGTGGG - Intergenic
1155867264 18:30981329-30981351 TTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1157352913 18:46906762-46906784 ATGTGTGTGTGTGGGGGGGGGGG + Intronic
1157377457 18:47179428-47179450 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1157407832 18:47438391-47438413 CTGTGTGGGTGAGTGGTGGAAGG - Intergenic
1157515474 18:48308148-48308170 GTGTGTGGGTGTGTGGTGGATGG - Intronic
1157535743 18:48456093-48456115 GTGTGTGTGTGTGTGCTGGAGGG + Intergenic
1157650674 18:49327023-49327045 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1157725906 18:49963669-49963691 CTGTGGGAGGCTGAGGTGGATGG - Intronic
1157804524 18:50648323-50648345 CTGTGTGGCTGTGGTGTGGGGGG + Intronic
1157918468 18:51692739-51692761 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158411913 18:57213511-57213533 ATGGGTGAGTGTGGAGTTGAGGG + Intergenic
1158440510 18:57470764-57470786 TTGTGTGTGTGTGGTGTGGAGGG - Intronic
1158504485 18:58034158-58034180 CTGTGTGTGTCAGGGGTGGGTGG - Intergenic
1158602271 18:58864648-58864670 CTGTGTGCTCGTGGGGTGGGGGG + Intronic
1158877362 18:61745921-61745943 GGGTGTGGGTGTGTGGTGGAGGG + Intergenic
1159014699 18:63091601-63091623 TTGTGTGTGTGTGTGGTGTATGG + Intergenic
1159079518 18:63721664-63721686 GTGTGTGTGTGTTGGGTGGTAGG + Intronic
1159079526 18:63721716-63721738 GTGTGTGTGTGTCGGGTGGTAGG + Intronic
1159361020 18:67402596-67402618 CTGTGTGTGTGTGGTGGGGTGGG - Intergenic
1159576517 18:70184744-70184766 GTGTGTGTGTGTGTGGTGGCGGG + Intronic
1159647835 18:70940769-70940791 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1159778366 18:72630538-72630560 GTGTGTGTGTGTGGGGGGGAGGG - Intronic
1159789321 18:72758397-72758419 GTGTGTGTGTGTGTGGAGGAGGG + Intronic
1159995440 18:74960251-74960273 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995447 18:74960287-74960309 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995454 18:74960323-74960345 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995461 18:74960359-74960381 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995522 18:74960647-74960669 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995530 18:74960683-74960705 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995553 18:74960791-74960813 CTGAGTGAGTGCTTGGTGGAGGG + Intronic
1159995561 18:74960827-74960849 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1159995568 18:74960863-74960885 CTGAGTCAGTGCTGGGTGGAGGG + Intronic
1160253148 18:77221588-77221610 TTGGGTGAGTGGTGGGTGGAAGG - Intergenic
1160426917 18:78783914-78783936 ATGTGTGAGTGTGGAGTGTATGG - Intergenic
1160523169 18:79520522-79520544 CTCTGTGTGTGGGGGGGGGAGGG + Intronic
1160654278 19:254188-254210 CTGTGGCAGTGTGGGGCGGTGGG + Intergenic
1160678857 19:404304-404326 CTGAGGGGGTGTGGGGGGGACGG + Intergenic
1160745721 19:709902-709924 CTGTGTGTGTGGGGGGGGGGTGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160859411 19:1231318-1231340 CTGTGTGTGTGTGGAGCGGGTGG - Intronic
1160908289 19:1462185-1462207 CTGTGTGCGGGTGGGGGGGTGGG - Intronic
1160977716 19:1802083-1802105 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1160977739 19:1802149-1802171 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1160977749 19:1802179-1802201 ATGGGTGGGTGAGGGGTGGATGG - Intronic
1161062831 19:2223548-2223570 CTGTGTGTGTGTGGGTGGGTGGG + Intronic
1161149671 19:2701429-2701451 TTGTGAGTGTGTGGGGTGGAAGG - Intronic
1161425549 19:4200764-4200786 CTTTGGGAGTCTGAGGTGGAAGG - Intronic
1161477141 19:4492853-4492875 CTGTGTGTGTGTGGTGTGTGTGG + Intronic
1161669675 19:5599178-5599200 CTGTGTGGGTTTAGAGTGGAGGG - Intronic
1161724549 19:5921007-5921029 GTGTGTGAGGGTGGTGTTGAGGG + Intronic
1161726029 19:5929575-5929597 CTGTGTGTGTGTGGGGCGGGAGG + Intronic
1161726368 19:5931575-5931597 CTATGTGAGTGGGGGTGGGAGGG - Intronic
1161883399 19:6973763-6973785 CTTTGGGAGGCTGGGGTGGACGG + Intergenic
1161887486 19:7007953-7007975 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1162116886 19:8435854-8435876 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1162312865 19:9917523-9917545 CTGTGTCTGCTTGGGGTGGAGGG + Intronic
1162336218 19:10062063-10062085 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1162794049 19:13077632-13077654 CAGTTTGGGTGAGGGGTGGAGGG - Intronic
1162966036 19:14156555-14156577 GTGTGTGTGTGTGGGGGGGGTGG + Intronic
1163064248 19:14781492-14781514 TTGTGTGTGTGTGAGGGGGACGG + Intergenic
1163191179 19:15678021-15678043 ATGAGTGAGTGTGGAGAGGAAGG - Intronic
1163258645 19:16173260-16173282 CTGTGTGAGTGTGGGGTGGAGGG - Intronic
1163421093 19:17214066-17214088 CTTTGGGAGGGTGAGGTGGATGG - Intronic
1163514859 19:17756659-17756681 CTGGGGGTGTGTGGGGTGCATGG - Intronic
1163609532 19:18293704-18293726 CGGAGGGAGTGTGGGGTGGGGGG + Intergenic
1163965792 19:20746220-20746242 CTTTGGGAGGCTGGGGTGGACGG - Intronic
1164015279 19:21251039-21251061 CTTTGGGAGTCTGAGGTGGATGG + Intronic
1164063828 19:21696920-21696942 GTGTGTGAATGTGGGGTTCAAGG - Intergenic
1164400654 19:27900035-27900057 ATGTGTGAGTGAGTGGTAGATGG - Intergenic
1164952698 19:32351459-32351481 GTGTGTGTGTGTGGCGTGGGGGG + Intronic
1165007708 19:32820028-32820050 CTCAGTGAGTGTGAGGAGGAAGG + Intronic
1165123382 19:33577820-33577842 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1165433123 19:35783611-35783633 CTGAGTGAGTGAGGGGCTGAGGG + Intronic
1165928081 19:39339702-39339724 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1165929013 19:39343984-39344006 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1165929015 19:39343986-39344008 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1165999947 19:39871936-39871958 TTGTGTGGGTGTGGGGTGGGAGG + Intronic
1166053230 19:40273682-40273704 AGGTGTGTGTGTGGGGTGGCAGG - Intronic
1166092024 19:40515482-40515504 CTGTGTGAGTGTGGAAGGGAAGG - Intronic
1166445685 19:42855955-42855977 CTGTGTGTGTGTGGGGGGGGGGG - Intronic
1166485285 19:43206752-43206774 CTGTGTGCTTGTGGGGAGAAGGG - Intronic
1166745899 19:45141745-45141767 CTGTGTGAAGGCTGGGTGGAGGG + Intronic
1166891953 19:45999416-45999438 GCGTGTGAATGTGGGGCGGAGGG + Intronic
1167116361 19:47491371-47491393 GTGTGTGTGTGTGGGGTGTGTGG + Intronic
1167423053 19:49415028-49415050 CTCTGTGGGTGTGGAGTGGATGG - Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1167741937 19:51329122-51329144 TTGTGTGTGTGTGGGGGGGTGGG + Exonic
1167997068 19:53414426-53414448 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
1168006850 19:53497107-53497129 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1168326706 19:55542436-55542458 GTGGGTGAGTGAGTGGTGGATGG - Intronic
1168398016 19:56065432-56065454 CTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1168415115 19:56162814-56162836 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1168530315 19:57122561-57122583 GTGTGTGAGTGTTGGAAGGAGGG + Intronic
1168682558 19:58326746-58326768 CTGTGTGAGGGTGAGGGTGAGGG - Intergenic
1168727478 19:58595191-58595213 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
925140666 2:1547853-1547875 CTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140683 2:1547966-1547988 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925140687 2:1548011-1548033 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
925175023 2:1776850-1776872 CTTTGGGAGGGTGGGGTGGGCGG - Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363247 2:3294405-3294427 GTGTGTGTGTGTGGAGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925727605 2:6888871-6888893 CTGTGAGGCTGTGGGCTGGAAGG + Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
925817521 2:7767997-7768019 CTGTGTGTGTGTGGTGTGTTGGG - Intergenic
925927985 2:8684528-8684550 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
925937578 2:8780528-8780550 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
926237172 2:11054692-11054714 AGGTGTGTGGGTGGGGTGGAGGG - Intergenic
926533238 2:14078582-14078604 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
926948525 2:18215939-18215961 GTGTGTGTGTGTGGTGGGGAGGG - Intronic
927095100 2:19742393-19742415 CTGTGTGTGTGTGTGTTGGGGGG - Intergenic
927219215 2:20691418-20691440 CTTTGTGAGGGTGAGGTGGGTGG - Intronic
927340757 2:21981248-21981270 ATGTGTGTGTTTGGGGTGGGGGG - Intergenic
927463543 2:23320445-23320467 CTGTGTGTGTGTGGGGGGGCGGG - Intergenic
927490000 2:23515028-23515050 CTGGGCTAGTGTTGGGTGGAGGG - Intronic
927507913 2:23626648-23626670 CTCAGTAAGTGTGGGGTGGGAGG + Intronic
927587115 2:24318023-24318045 CTATGTGTCAGTGGGGTGGAAGG - Intronic
927735417 2:25516494-25516516 CTTTGGGAGTCTGGGGTGGGAGG - Intronic
927825510 2:26306840-26306862 CTTTGAGAGTCTGAGGTGGAAGG - Intergenic
927889927 2:26741876-26741898 TTGTGAAAGTGTGGGGAGGAGGG + Intergenic
927917854 2:26948066-26948088 GTGTGTGTGTGTGTGGTGGCAGG - Exonic
928280401 2:29941316-29941338 GTGTGTGTGTGTGTGGTGGCAGG + Intergenic
928304416 2:30154980-30155002 CTTTGTGAGTCTGAGGTGGGCGG - Intronic
928392596 2:30920906-30920928 CAGTGTGAATGTGGGGTGCTGGG - Intronic
928664510 2:33537321-33537343 GTGTGTGTGTGTGGGGGGGGCGG - Intronic
928887550 2:36167372-36167394 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929043244 2:37767319-37767341 CCATGTGAGTGTGGGGTTGGAGG - Intergenic
929074546 2:38068913-38068935 GTATGTGTGTGTGGGGTGGGGGG - Exonic
929358990 2:41060640-41060662 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
929768110 2:44867680-44867702 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
930019005 2:46989844-46989866 CTGTGTGTGTGTGTTTTGGAGGG + Intronic
930233332 2:48864907-48864929 TAGTGTGTGTGTGTGGTGGAGGG + Intergenic
930274599 2:49296865-49296887 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
930383709 2:50664427-50664449 GTGTGTGTGTGTGGCGTGGCGGG + Intronic
930393460 2:50790128-50790150 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
930394286 2:50800791-50800813 CTTTGTGAGGCTGGGGCGGATGG - Intronic
931372006 2:61672298-61672320 CTGGGTGAGGGAAGGGTGGATGG + Intergenic
931937502 2:67214893-67214915 ATATGTGTGTGTGGGGTGGTGGG - Intergenic
932006263 2:67930182-67930204 ATGTGTGGGTGAAGGGTGGATGG + Intergenic
932036393 2:68251731-68251753 CAGAGTGAGTGTGGAGGGGAGGG + Intronic
932072705 2:68636792-68636814 TTGTGTGTGTGTGGGGCGGGGGG + Intergenic
932156545 2:69423195-69423217 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
932188307 2:69717360-69717382 CTTTGGGAGTGTGGGATGAAAGG - Intronic
932348123 2:71008902-71008924 GTGTGTCAGTGTGTGATGGAGGG - Intergenic
932370415 2:71182666-71182688 CCGTGTGTGTTTGGGGTGGGGGG - Intergenic
932427564 2:71649644-71649666 CTTTCTGTGTGTGGGGCGGATGG - Intronic
932493934 2:72137496-72137518 GTGTGTGAGTAGGGGCTGGAAGG - Intronic
932529914 2:72518506-72518528 GTGTGTGTGTGTGTGGTGGGTGG + Intronic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
932658367 2:73629995-73630017 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
932697441 2:73968573-73968595 GTGTGTGTGTGTGGGGGGGTAGG - Intergenic
932918912 2:75887333-75887355 GTGTGTGTGTGTGTGTTGGAAGG - Intergenic
933534237 2:83552265-83552287 CTGTGTTAGTTTGAGGAGGATGG + Intergenic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
934584069 2:95474218-95474240 GTGTGTGGGTGTGGGGTGTATGG - Intergenic
934595383 2:95602496-95602518 GTGTGTGGGTGTGGGGTGTATGG + Intergenic
934601457 2:95661736-95661758 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
934610117 2:95729295-95729317 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
934638829 2:96013896-96013918 CTTTGGGAGTGTGGGGTCAAAGG - Intergenic
934787388 2:97023038-97023060 GTGTGTGGGTGTGGGGTGTATGG - Intergenic
934794822 2:97091515-97091537 CTTTGGGAGTGTGGGGTCAAAGG + Exonic
934981869 2:98849619-98849641 CTGGCTGAGAGTAGGGTGGAAGG - Intronic
935116533 2:100142203-100142225 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
935255491 2:101306663-101306685 CTGTGGGAGTATGGGTTGGTGGG - Intronic
935560959 2:104559448-104559470 CTGTGTGAGTGCCGGGTTGTGGG + Intergenic
935919852 2:108001146-108001168 GTGTGTGGGTGGGGGGAGGAGGG - Intronic
936007564 2:108904804-108904826 CTAGGTGAGGGTGGGGTGGGTGG + Intronic
936062041 2:109301292-109301314 CTGTGTGTGTATGTGGTGGGGGG + Intronic
936239834 2:110777786-110777808 CTGTGTGTATGTGGGGTTGAGGG + Intronic
936321097 2:111467749-111467771 ATGTGTGTGTGTGGGGGGGGGGG + Intergenic
936534821 2:113303904-113303926 GTGTGTGTGAGAGGGGTGGAGGG + Intergenic
936571074 2:113616003-113616025 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
936572606 2:113628875-113628897 CGTTGTGTGTGTCGGGTGGAGGG + Intronic
936573103 2:113632782-113632804 CTGTGTGGCTGTGGAGTGAAAGG + Intronic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
937000467 2:118461392-118461414 CTGGGTGAGTGTGGGTGGGGGGG - Intergenic
937000867 2:118466486-118466508 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
937246138 2:120495198-120495220 GTGTGTGTGTGGGGGGGGGAGGG - Intergenic
937311872 2:120907760-120907782 CTGTGTGTGTGTGTGTTGGGGGG - Intronic
937959884 2:127449524-127449546 ATGTGTTAGTGAGGGGTGGAGGG + Intronic
938135955 2:128756649-128756671 GTGTGTGGGTGTGGTGTGGATGG + Intergenic
938239135 2:129729420-129729442 TTGTGTGATTGTGGGGATGAAGG - Intergenic
938269019 2:129952489-129952511 CTGTGGGAGGGTGAGGTGGGTGG - Intergenic
938370869 2:130767660-130767682 GTGTGTGAGTCTTGGGAGGAGGG - Exonic
938385797 2:130866125-130866147 CTTTGGGAGTCTGAGGTGGAAGG + Intronic
939334369 2:140806506-140806528 AGGTGTGAGTGAAGGGTGGAGGG + Intronic
939382143 2:141448852-141448874 ATGTGTGAGGATTGGGTGGATGG - Intronic
939548281 2:143581368-143581390 CTATGGGGCTGTGGGGTGGAAGG - Intronic
939704259 2:145432457-145432479 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
939939324 2:148330041-148330063 GTGTGTGTGTGTGGGGGGGGCGG - Intronic
939970682 2:148656013-148656035 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
940289793 2:152067377-152067399 ATGTGTGTGTGTGGGGGGGGGGG + Intronic
940375545 2:152954186-152954208 ATGTGTGTGTGTGGGTTGGGGGG + Intergenic
940865766 2:158816554-158816576 GTGTGTGTGTGTGTGGTAGAGGG - Intronic
941155063 2:161967265-161967287 GTGTGTGAGTGTGTGCTGCAAGG + Intronic
941200159 2:162498480-162498502 CTCTGTGTGTGTGGGGGGGAGGG + Intronic
941334057 2:164218650-164218672 ATGTGTGTCTGTGTGGTGGAGGG + Intergenic
941937585 2:170997368-170997390 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
942042648 2:172081170-172081192 GTGCGTGCGTGTGGGGTGGGTGG - Exonic
942655176 2:178207716-178207738 CTGTGTTTGTCTGGGGAGGAGGG + Intronic
942837055 2:180313372-180313394 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
943230703 2:185247126-185247148 CAGTGTGTGTGTGTGCTGGAGGG + Intergenic
943355475 2:186849814-186849836 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
943851566 2:192729766-192729788 CTGTGTTAGTGTGGAGAGGTGGG + Intergenic
943950434 2:194127997-194128019 GTGTGTGAGTGTGTGGTGGGGGG - Intergenic
944501118 2:200361076-200361098 ATGTGTGTGTGTGGGGGGGTGGG - Intronic
944536748 2:200717726-200717748 CTGTGGGAGGCTGAGGTGGAAGG + Intergenic
944636681 2:201681824-201681846 CTGTTTCAGTGTAGGGTGGGGGG - Intronic
944823753 2:203459003-203459025 CTTTGGGAGTCTGAGGTGGATGG - Intronic
945098080 2:206238536-206238558 CTTTGGGAGGCTGGGGTGGATGG - Intergenic
945385423 2:209193696-209193718 CAGTGTGAGTGTGGGGGTGAGGG - Intergenic
945948320 2:216015199-216015221 GCGTGTGTGTGTTGGGTGGAGGG + Intronic
946044712 2:216811280-216811302 AAGTGTGAGGGTGGGGTGGTGGG + Intergenic
946076025 2:217074379-217074401 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
946144412 2:217718129-217718151 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
946200854 2:218069936-218069958 CTGCGTGTGTGTGGGGAGCAGGG - Intronic
946431960 2:219630915-219630937 CAGTGTGTGGGTGGGGTGGGGGG + Intronic
946586118 2:221189690-221189712 CTGTGTGTGTTTGGGGGGCAGGG - Intergenic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946673906 2:222136713-222136735 GTGTGTGTGTGTGTGATGGAGGG + Intergenic
946735088 2:222745876-222745898 GTGTGTGTGTGTGGGGAGGGGGG - Intergenic
946966151 2:225040534-225040556 GTGTGTGTGTGTGGTGTAGAAGG + Intronic
946981404 2:225220100-225220122 CTGTTGGGGAGTGGGGTGGAGGG - Intergenic
947017537 2:225638180-225638202 GTGTGTGTGTGTGGTGTGGGAGG + Intronic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947100686 2:226618160-226618182 TTGTGTGAGTGTGCTGGGGATGG - Intergenic
947108712 2:226695723-226695745 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
947333447 2:229054708-229054730 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
947391217 2:229641510-229641532 GTGTGTGTGTGTGGGGCGGGGGG - Intronic
947662912 2:231883169-231883191 TTGTGTGTGTGTGGGGGGGGTGG + Intergenic
947732338 2:232438388-232438410 CTGTCTGGGGGAGGGGTGGAGGG - Intergenic
947749645 2:232525604-232525626 CTGGGTGTGTGTGGGTGGGATGG + Exonic
947916783 2:233837841-233837863 CTGGGGGAGTGTGGGGAGCAGGG - Intronic
947994302 2:234514214-234514236 CTGTATGTGTGTGGTGTGGGGGG + Intergenic
947995766 2:234525908-234525930 CTGGGTGTGTGTGGGTGGGATGG - Intergenic
948166670 2:235867866-235867888 CTGGGTGGGTGGTGGGTGGATGG - Intronic
948183854 2:236003605-236003627 AAGGGAGAGTGTGGGGTGGAGGG - Intronic
948217031 2:236239635-236239657 CTCTATGACTGTGGGCTGGATGG + Intronic
948222880 2:236287445-236287467 CTGTGTGCCTGTGGGGTTAAGGG + Intergenic
948276343 2:236711904-236711926 GTGTGTGTGTGTGGTGTGTAGGG - Intergenic
948372768 2:237500776-237500798 CTGGCTGAGTGTGGGGTGTGGGG - Intronic
948374513 2:237512613-237512635 CCGTGTGCGTGTGGGGAGGTGGG - Intronic
948385623 2:237578799-237578821 CTGGGTGTGTATGGGGTGCAGGG - Intronic
948563635 2:238870113-238870135 GTGTGTGTGTGGGGGGTGTATGG - Intronic
948892779 2:240915424-240915446 CTCTGTGAGGGTGCAGTGGATGG - Intergenic
949087939 2:242173172-242173194 CTGCGTCAGTGTGGGGCGGTGGG - Intergenic
1168868529 20:1109296-1109318 CTGTGTGTATGTAGGGTGGTGGG - Intergenic
1168870541 20:1123821-1123843 CTGTGTAGGTGTGGGGAGAATGG - Intronic
1168937736 20:1681416-1681438 CTATGTGTGTGTGTGGTGGGGGG + Intergenic
1169141374 20:3229063-3229085 GTGGGTGAGGGTGGGGTGGGCGG - Intronic
1169689799 20:8317520-8317542 GTGTGTGTGTGTCGGGGGGATGG - Intronic
1169781190 20:9312343-9312365 GTGTGTGTGTGTAGGGTGGAAGG - Intronic
1169840667 20:9933271-9933293 CTGTGGCAGAGTGGAGTGGACGG + Intergenic
1169926373 20:10788637-10788659 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1170093974 20:12624423-12624445 CTGTGTATGTGTGGGGGCGAGGG + Intergenic
1170322294 20:15113786-15113808 GTGTGTGTGTGTGTGCTGGAGGG + Intronic
1170549397 20:17463659-17463681 GTGTGTGTGTGGGGGGTGGGGGG - Intronic
1170731870 20:18983048-18983070 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
1170859566 20:20090155-20090177 ATGTGTGGGTGTGGGATGCAGGG - Intronic
1171098913 20:22363689-22363711 CTGTGTGTGTGTGTGGGGGTGGG - Intergenic
1171216312 20:23355043-23355065 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1171234550 20:23513578-23513600 ATGTGTGTGTGTGTGGTGGAGGG - Intergenic
1171428966 20:25067169-25067191 GTGTGTGTGTGTGGTGTGGGGGG - Intergenic
1171502418 20:25604016-25604038 CTGTGGGGGTGTGGGATGGTTGG - Intergenic
1172099688 20:32477749-32477771 CTGGCTGTGTGTGGGGTGGCTGG - Intronic
1172458148 20:35093618-35093640 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1172488188 20:35312543-35312565 CTGTGAGAGTGCAGGGAGGATGG + Intronic
1172633698 20:36395060-36395082 GTGTGTGTGTGTTGGGTGAAGGG - Intronic
1172666949 20:36606666-36606688 CTGGGTGAGTGTGAGGTGTGGGG + Intronic
1172798154 20:37557621-37557643 GTGTGTGTGTGTAGGGTGGTAGG + Intergenic
1172803027 20:37591578-37591600 CTGTGTGGGTTTGGGGAGGAAGG - Intergenic
1172861760 20:38059798-38059820 TTGTGTGCGTGTGGGGTGGGTGG + Intronic
1172946103 20:38690676-38690698 ATGTGTGTGTGTTGGGGGGAGGG + Intergenic
1173092443 20:39986029-39986051 GTGTGTGTGTGTGGTGTGTAGGG - Intergenic
1173104264 20:40118006-40118028 TGGTGTGAGTGAGGGGTGGGAGG + Intergenic
1173586523 20:44187052-44187074 CAGTGAAAGGGTGGGGTGGAGGG + Exonic
1173617322 20:44411528-44411550 GTGTGGGCGGGTGGGGTGGACGG + Intronic
1173635105 20:44548847-44548869 GTGTGTGTGTGTGTGGTGGGAGG - Intronic
1173653774 20:44684771-44684793 GTGTGTGTGTGGGGGGGGGAGGG + Intergenic
1173771964 20:45667434-45667456 CTGGGTGATTGTGGAGTGGAAGG + Intronic
1174080552 20:47968385-47968407 CTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1174306065 20:49615071-49615093 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1174306881 20:49619577-49619599 ATGTGTGGGTGGGGGATGGATGG + Intergenic
1174467452 20:50729241-50729263 CTGTGTGAGTGAGTGTTGGGTGG - Intergenic
1174485955 20:50861395-50861417 CAGTGTGGGCCTGGGGTGGAGGG + Intronic
1174568376 20:51483608-51483630 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1174575945 20:51537245-51537267 ATGTGTGGGTGGGGGGTGCAGGG + Intronic
1175133250 20:56805372-56805394 GTGTGTGAGTGTGTGGGGGGAGG - Intergenic
1175244823 20:57575678-57575700 CTGCGTGAGGATTGGGTGGATGG + Intergenic
1175314932 20:58040537-58040559 ATGTGTGTGTGTGGGGTGGGGGG - Intergenic
1175573970 20:60046585-60046607 CTGTGTGAGAGTGGGTGGCAGGG + Intergenic
1175829038 20:61952047-61952069 GTGAGTGAGTGGGGGGTGCAGGG - Intergenic
1175862838 20:62159363-62159385 CTGGGTGTGGGTGGGGTGAAGGG + Intronic
1175948734 20:62571394-62571416 CTGTGTGATTGTGTGGTGGGGGG - Intergenic
1176242777 20:64082807-64082829 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1176366848 21:6038353-6038375 ATGTGTGTGTGAGGGGTGGGGGG + Intergenic
1176591264 21:8652389-8652411 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1177348175 21:19900317-19900339 CTGTGCATGTGTAGGGTGGAGGG - Intergenic
1177721373 21:24910928-24910950 ATGTGTGTGTGTGGTGGGGAGGG - Intergenic
1177758162 21:25372466-25372488 CTGTGTGAATTAGAGGTGGATGG + Intergenic
1178021846 21:28417255-28417277 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1178109492 21:29356079-29356101 CTGTGAGAGTGTGTGGTAGTAGG + Intronic
1178153970 21:29830298-29830320 GTGTGTGTGTGTGGGGAGGTGGG - Intronic
1178157476 21:29872005-29872027 CTTTGGGAGGCTGGGGTGGATGG - Intronic
1178519382 21:33275397-33275419 CTTTGTGAGTCTGAGGTGGGCGG - Intronic
1178753797 21:35328623-35328645 CTGTGGGAGTTGGGGGTTGAGGG + Intronic
1178837865 21:36113666-36113688 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1178842349 21:36147896-36147918 CTTTGTGAGGCTGGGGTGGGCGG - Intergenic
1178908607 21:36656041-36656063 GAAGGTGAGTGTGGGGTGGAGGG - Intergenic
1179180651 21:39041987-39042009 ATGTGTGTGTGTGGTGTGAAGGG - Intergenic
1179261704 21:39763675-39763697 CAGGGTGAGTGTGGGGATGATGG - Intronic
1179453886 21:41485108-41485130 GTGTGTGTGTCTGGGGTGTATGG + Intronic
1179467340 21:41585189-41585211 GTGTGTGAGTGTGGTGTGTGTGG - Intergenic
1179532203 21:42027545-42027567 GTGTGTGTGTGTGGTGTGGGGGG + Intergenic
1179652380 21:42820020-42820042 CTGTGTGCTTGTGGGAGGGAAGG + Intergenic
1179656505 21:42849190-42849212 CTGTGTGTGTGTGAGGTGCGCGG - Intronic
1179756670 21:43500191-43500213 ATGTGTGTGTGAGGGGTGGGGGG - Intergenic
1179998297 21:44984087-44984109 GTGTGTGGGTGTGGGGTGTGTGG - Intergenic
1179998302 21:44984102-44984124 GTGTGTGGGTGTGGGGTGTGTGG - Intergenic
1180256551 21:46633747-46633769 GTGTGTGTGTGTGGTGGGGAGGG + Intergenic
1180262919 21:46686993-46687015 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1180274112 22:10629500-10629522 CTGTGCGGCTGTGGGGTGGGGGG + Intergenic
1180663659 22:17491571-17491593 GTGTGTGTGTGTGGGGGGGTGGG + Intronic
1181039284 22:20184322-20184344 ATGTGGGACTGTGGGGTGCATGG - Intergenic
1181068169 22:20316357-20316379 CTGGGTGACAGTGGGGTGGGAGG - Intronic
1181339308 22:22165672-22165694 CTGTGTAAGTGAGGGGCAGAAGG + Intergenic
1181478648 22:23183543-23183565 CTATGTGGGGGCGGGGTGGAAGG + Intronic
1181586786 22:23857062-23857084 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1182118550 22:27772409-27772431 CAGTTAGAGTGTGGGGAGGAGGG + Intronic
1182243167 22:28933721-28933743 GTGTGTGTGTGTGGGGGGGGTGG - Intronic
1182321347 22:29480138-29480160 CAGTGAGAGGGTGGGGAGGAGGG - Intergenic
1183027357 22:35075652-35075674 ATGTGTGGGTGTGTGGTGGGGGG + Intronic
1183227863 22:36562732-36562754 CTGTGTGCGTGTGGGGTGTGTGG + Intergenic
1183267496 22:36838186-36838208 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1183279460 22:36924248-36924270 GAGTGTGAGTGTGGGGTGGGTGG - Intronic
1183284151 22:36952069-36952091 GAGTGTGAGTGTGGGGTGGGTGG + Intergenic
1183816692 22:40307775-40307797 CAGCCTGAGTGTGGGGTGGGTGG - Intronic
1183866723 22:40710195-40710217 CTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1184160322 22:42693734-42693756 CCGTGGGAGGGTGGGGTGGGGGG + Exonic
1184203516 22:42985643-42985665 CTGTGTGTGTGTCTGTTGGAGGG - Intronic
1184203909 22:42988323-42988345 ATGTGTGAGTGAGGGGTGGGGGG + Intronic
1184268895 22:43366287-43366309 CTCTGTGTGTCTGGGGTGGGTGG - Intergenic
1184297328 22:43533240-43533262 CTCTGAGTGTGTGTGGTGGATGG - Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184399657 22:44266544-44266566 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1184565832 22:45291355-45291377 GTGTGTGAGAGTGGTGTGGGTGG + Intronic
1184727472 22:46355337-46355359 CTGTGTGTGTGTGTGCTGGTAGG + Intronic
1184866488 22:47204483-47204505 CTGTGTGCCTGTGGGGAGGAGGG - Intergenic
1185068001 22:48641585-48641607 CGGAGGGCGTGTGGGGTGGAGGG - Intronic
1185119336 22:48956476-48956498 ATGTGTGTGTGTGGTGTGTATGG - Intergenic
1185288680 22:50013599-50013621 GTGTGTGTGTGGGGGGGGGATGG + Intergenic
1185427082 22:50778092-50778114 CTGTGTGGCTGTGGAGTGAAAGG - Intronic
1185429119 22:50794867-50794889 CTGCGTCAGTGTGGGGCGGTGGG - Intergenic
949443854 3:4112772-4112794 CTGTTGGATAGTGGGGTGGAGGG - Intronic
949523844 3:4883305-4883327 CTGTGTGTGTCTAGGGTGGTTGG + Intronic
950340642 3:12241061-12241083 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
950491506 3:13307924-13307946 GTGTGTGAGTGTTGAGGGGAGGG - Intergenic
950768936 3:15295081-15295103 CTGTGTGTGTGTGTGTTGGCGGG - Intronic
950841893 3:15975812-15975834 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
950903582 3:16517629-16517651 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
951118127 3:18889686-18889708 GTGTGTGTGTGTGTTGTGGAGGG + Intergenic
951264201 3:20547976-20547998 CCGGGTGGCTGTGGGGTGGAGGG + Intergenic
951325411 3:21296896-21296918 CTGCCTGGGTGTGGAGTGGAGGG - Intergenic
951363517 3:21752018-21752040 TTGTGTGTGTGTGTGGTGGGGGG - Intronic
951419379 3:22466323-22466345 CTGTCAGAGAGCGGGGTGGAGGG - Intergenic
951425387 3:22538583-22538605 GTGTGTGTGTGTGGTGTGGGGGG - Intergenic
951588436 3:24238267-24238289 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
951614208 3:24523162-24523184 CTTTGTGTGTGGGGGGGGGAGGG + Intergenic
951895589 3:27606751-27606773 ATGTGTGTGTGTGGAGAGGATGG + Intergenic
952127699 3:30321163-30321185 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
952643354 3:35625204-35625226 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
952740473 3:36729237-36729259 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
952818967 3:37469382-37469404 CTGTGTGTGTGGTGGGTGGTAGG + Intronic
952863678 3:37836258-37836280 CTTTGGGAGGCTGGGGTGGATGG - Intergenic
952881745 3:37990132-37990154 CTCTCTCACTGTGGGGTGGAGGG - Intronic
952917916 3:38263468-38263490 GTGTCCGTGTGTGGGGTGGAGGG - Intergenic
953293170 3:41686972-41686994 CTTTGGGAGTGTGAGGTGGGAGG + Intronic
953444665 3:42952826-42952848 TTGTGTGTGTGTGGGGGGGGGGG - Intronic
953548978 3:43885880-43885902 GTGCGTGCGTGTGGGGTGGGTGG - Intergenic
953800034 3:46015836-46015858 CTGTGGGAATGTGGGGTAGGAGG - Intergenic
953909408 3:46884097-46884119 GTGTGTGTGTGAGGGCTGGAGGG - Intronic
954455848 3:50599448-50599470 CTCTGTGACATTGGGGTGGATGG + Intergenic
954526752 3:51278661-51278683 CTGTGTAAGTGTTGGTTAGAAGG - Intronic
954583666 3:51717244-51717266 GTGCGTGAGTGTAGGGTGCATGG - Intronic
955083615 3:55680624-55680646 ATGTGTGAGTGTGGGGTTTGGGG + Intronic
955221417 3:57026424-57026446 CTGTGCAAGCGTGGGGTGGGAGG - Intronic
955576406 3:60369213-60369235 CTGTGTGAGGCTGAGGTGGGAGG - Intronic
956167718 3:66408948-66408970 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
956312521 3:67897026-67897048 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
956638441 3:71390563-71390585 GTGTGTGTGTGTGGTGGGGAGGG + Intronic
956749995 3:72337688-72337710 TGGTGTGTGTGTGGGGGGGAGGG + Intergenic
956789449 3:72669169-72669191 TTGTGTGGGTGTGGGGGGAATGG - Intergenic
956916402 3:73876392-73876414 CCTTCTGGGTGTGGGGTGGAAGG + Intergenic
957079958 3:75628903-75628925 CTGTGTCAGTGTGGGGTGGTGGG + Intergenic
957124912 3:76146716-76146738 GTGTGTGTGTGTCTGGTGGAGGG + Intronic
957124930 3:76146857-76146879 GTGAGTGTGTGTGTGGTGGAGGG - Intronic
957310246 3:78509824-78509846 CTTTTTGAGAGTGGGGTGGTGGG - Intergenic
957536097 3:81505707-81505729 GTCTGTTAGTGTGTGGTGGAGGG + Intronic
957556744 3:81771891-81771913 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
957698760 3:83681097-83681119 CAGTGTAGGGGTGGGGTGGAGGG + Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
957976575 3:87453313-87453335 CTGTCAGAGGGTGGGGTGGGGGG - Intergenic
958072356 3:88630333-88630355 CTGTGTGTGTGTGTGGGGGGGGG - Intergenic
958645036 3:96859161-96859183 GTGTGTGAGTGTGTGTTGGGGGG - Intronic
959037127 3:101380436-101380458 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
959063051 3:101633253-101633275 CTGTGTGAGTGTGTTGTGAATGG + Intergenic
959396595 3:105847385-105847407 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
959863899 3:111244253-111244275 GTGTGTGTGTGTAGGGTGGGAGG + Intronic
959941371 3:112085370-112085392 GTGTGTGTGTGTTGCGTGGAGGG + Intergenic
960056228 3:113278463-113278485 CTGTGTGAGAGAGGGATGAAGGG - Intronic
960173106 3:114486126-114486148 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
960268872 3:115652627-115652649 CTTTGTGAGGCTGGGGTGGGAGG - Intronic
960395855 3:117136381-117136403 AAGTGTGAGGGTGGGGTTGAGGG - Intronic
960704022 3:120464750-120464772 CTGGGAGAATGTGGGGAGGATGG + Intergenic
960708626 3:120505526-120505548 TGGTGTGTGTGTGTGGTGGAAGG - Intergenic
960717114 3:120586768-120586790 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
960781445 3:121322669-121322691 GTGTGTGTGTGTGGGGTGGGGGG + Intronic
960836417 3:121911275-121911297 CTGTGTGTGTGTGGAGTGAGCGG + Intronic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961053130 3:123764454-123764476 CTTTGGTGGTGTGGGGTGGAGGG + Intronic
961110318 3:124278014-124278036 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
961110381 3:124278475-124278497 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
961328703 3:126126579-126126601 CTGGGTGTGTGTGGGGTGTGGGG - Intronic
961390410 3:126549252-126549274 ATGTGTGTGTGTGGGGGGGGGGG - Intronic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961901528 3:130217609-130217631 GTGTGTGTGTGTGGTGTGAAGGG - Intergenic
962317577 3:134368374-134368396 CTGGGTGAGTGGGGGGTGGGGGG - Intronic
962323160 3:134407683-134407705 ATGTGTGGGTGAGGGGAGGAAGG - Intergenic
962468879 3:135687437-135687459 GTGTGTGTGTGTGTGTTGGAGGG + Intergenic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962755179 3:138460866-138460888 GTGTGTGTGTGTGGTGTGGGCGG - Intronic
962830795 3:139137781-139137803 GTGTGTGTATGTGGGGTGCACGG - Intronic
962924451 3:139978692-139978714 GTGTGTGTGTGTTGTGTGGAAGG + Intronic
963138026 3:141925221-141925243 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
963209201 3:142670078-142670100 CTGTGAGAGTTTGTGGTAGAAGG + Intronic
963320682 3:143806097-143806119 CTGTGTGTGTGGGTGGGGGACGG - Intronic
963343341 3:144064345-144064367 ATGTGTGTGTGTGTGGTGGGGGG + Intergenic
963431854 3:145216804-145216826 CTGTGTGTGTGGGGGTGGGAGGG + Intergenic
963525629 3:146411042-146411064 CTGTGTGAATGGTGTGTGGATGG - Intronic
964054967 3:152443181-152443203 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
964670143 3:159216076-159216098 GTGTGTGTGTGTGGGGCGGGGGG + Intronic
964798047 3:160521353-160521375 CTTTGGGAGGCTGGGGTGGAAGG + Intronic
965192265 3:165547050-165547072 TTTTGTGAATGTGGGGTGGGGGG - Intergenic
965211049 3:165790059-165790081 GTGTGTGTGTGAGGGGGGGATGG + Intronic
965285462 3:166813763-166813785 ATGTGTGTGTGTGGGGCGGGGGG - Intergenic
965450526 3:168832875-168832897 CTGGGCCAGGGTGGGGTGGATGG - Intergenic
965594520 3:170397486-170397508 CTTTGGGAGTCTGGGGTGGGAGG + Intergenic
965795954 3:172438850-172438872 CTGTGGGTGTGTGGAGTGGGGGG - Intergenic
965885272 3:173437778-173437800 CTGTGTGTGTGTGTGTTGGTGGG - Intronic
966729670 3:183140161-183140183 CTGTGTGAGACTGAGGTGGGTGG + Intronic
966880116 3:184345316-184345338 CTGTGTGAGGGTGGGGTGGGAGG + Intronic
966890855 3:184406512-184406534 CTGTGTGAGTGGGGTGCGGGGGG + Intronic
966919977 3:184604745-184604767 CTGAGAAAGTGTGGAGTGGAAGG + Intronic
966925610 3:184642838-184642860 GTGTGTGCGTGTGGAGTGAAGGG + Intronic
967410240 3:189159854-189159876 GTGTGTGTGTGTGTGGTGGTGGG + Intronic
967882557 3:194312297-194312319 CTTTGGGAGTCTGAGGTGGAAGG - Intergenic
968017610 3:195352703-195352725 CTCTTTGAGTGTGGGCTAGATGG + Intronic
968057291 3:195701969-195701991 CTGTGGGTGGCTGGGGTGGACGG + Intergenic
968194508 3:196695352-196695374 GTGTGTGGGTGTGGGGTGTGTGG - Intronic
968373599 4:18312-18334 CTGTGTCAGTGTGGGGCGATGGG + Intergenic
968449268 4:667487-667509 CCGTGTGTGTGTGGGAGGGACGG + Intronic
968521356 4:1036101-1036123 CCGGGAGGGTGTGGGGTGGAGGG - Intergenic
968579537 4:1383503-1383525 CTGTGGGGGTGTGGGGCGGTGGG + Intronic
968795261 4:2699437-2699459 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
968797331 4:2716280-2716302 TTGTGTGAGTGTTGGGAGTATGG - Intronic
968868592 4:3229066-3229088 GTGTGTGTGTGTGGGGTGTGTGG - Intronic
968960703 4:3741952-3741974 CTGTGTGTGTGTGTGGTTGCAGG - Intergenic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
969115632 4:4869158-4869180 CTTTGTGTGTGTGTGGTGGGGGG + Intergenic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969293847 4:6257563-6257585 CTGTGTGAGGGTGGGGAAGGAGG + Intergenic
969327437 4:6452077-6452099 CTGTGTAAGTGTGGGGAGGTTGG + Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969832169 4:9806664-9806686 CTGTGTGCATGGGGGGTGGGAGG + Intronic
969894493 4:10290823-10290845 GTGTGTGTGTGTGGGGGGGGTGG + Intergenic
970240864 4:14007501-14007523 ATGTGTGGGGGTGGGGTGGGGGG - Intergenic
970416254 4:15860222-15860244 GTGTGTGTGTGTGTGGTGGAGGG + Intergenic
970523522 4:16909089-16909111 GTGTGTGTGTGTGGGGGGGGCGG - Intergenic
970930154 4:21501704-21501726 GTGTGTGTGTGTGCGTTGGAAGG + Intronic
971598153 4:28558245-28558267 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
971599547 4:28575012-28575034 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
972059597 4:34853028-34853050 ATGTGTGTGTGTGGGGGGGGGGG + Intergenic
972648397 4:40992007-40992029 CAGTGTGAGTGTGGTGTGTGTGG - Intronic
972688014 4:41369681-41369703 TTGTGTGTGTGTGTGGTGGGGGG + Intronic
973110353 4:46390203-46390225 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
973207071 4:47572665-47572687 GTGTGTGTGTGTGTGTTGGATGG + Intronic
973570477 4:52233937-52233959 TTGTGTGTGTGGGGGGGGGAGGG + Intergenic
973837158 4:54821588-54821610 CTGGCTGAGTGTGGGATGCAGGG + Intergenic
973862374 4:55077947-55077969 ATGTGTGGGTGTGGGGGGGCTGG + Intergenic
973967764 4:56181473-56181495 TTGTGTGTGTGCTGGGTGGAGGG - Intronic
974335566 4:60540010-60540032 GAGTTTGTGTGTGGGGTGGAGGG - Intergenic
974531269 4:63110805-63110827 CTGTTGGAGGGTGGGGTGCAAGG + Intergenic
974967455 4:68779161-68779183 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
974967457 4:68779163-68779185 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
974996771 4:69170420-69170442 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
975025365 4:69542221-69542243 CTGTGGGTTTGTGGGGTGGGAGG - Intergenic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975241977 4:72070549-72070571 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
975566264 4:75758637-75758659 CTTTGGGAGGCTGGGGTGGAAGG + Intronic
975597657 4:76065546-76065568 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
975799501 4:78045119-78045141 GTGTGTGTGTGTGTGGGGGAGGG + Intergenic
975986345 4:80203739-80203761 CTGTGTGTGTGTGTGGGGGGGGG - Exonic
976586402 4:86802167-86802189 GTGTGTGTGTGTGGTGTGTAAGG + Intronic
976686225 4:87818739-87818761 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
976894099 4:90086604-90086626 ATGTGTGTGTGTGGGGGGGGGGG + Intergenic
977322200 4:95531770-95531792 TGGTGTGAGTGTGAGGTGGTGGG - Intronic
977491383 4:97716693-97716715 CTGTGGGGGTGGGGGGTGGAAGG + Intronic
977504261 4:97882016-97882038 TTGTGTGTGTGTGGGGAGGGGGG - Intronic
978435434 4:108679058-108679080 GTGTGTGTGTGTGTGGTAGAGGG - Intergenic
978544566 4:109857260-109857282 TTTTGTGAATGTGGGGTGGGGGG + Intronic
978571109 4:110138724-110138746 ATGTGTGGATGTGGGGTGGGGGG + Intronic
978645782 4:110929686-110929708 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
978973064 4:114834268-114834290 CTGTGTGAGGCTGAGGTGGGTGG + Intronic
979515891 4:121609636-121609658 CTGTGTGAGTGTGTGTTTGCAGG + Intergenic
979785019 4:124705674-124705696 CTAAGTTAGTGAGGGGTGGAGGG - Intronic
979835318 4:125359798-125359820 CTGTGTGTTTGTGGGGAGGGAGG + Intronic
980104026 4:128570156-128570178 GTGTGTGTGTGTGTGGTTGAGGG - Intergenic
980295883 4:130916061-130916083 CTCTATGAGTGTTGAGTGGAGGG - Intergenic
980348216 4:131652372-131652394 GTGTGTGTGTGTGGGGCGGGGGG - Intergenic
980737778 4:136913408-136913430 GTGTGTGTGTGTGGGGGGGTGGG - Intergenic
980986093 4:139695878-139695900 CTGTGTGTGTGTGGGGCGGGGGG - Intronic
981229080 4:142331906-142331928 CTGGGGGGGTGGGGGGTGGAGGG + Intronic
981478428 4:145211195-145211217 CTGTGTCAGTCTGTGGGGGAAGG - Intergenic
981519932 4:145650793-145650815 CTGTGAGAGTGAGGAGAGGATGG + Intronic
981717431 4:147765326-147765348 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
981774921 4:148355444-148355466 CAGTGTGGGAGTGGGGTAGAGGG - Intronic
982236974 4:153260691-153260713 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
982255024 4:153443211-153443233 TTTTGTGAGTGGGGAGTGGAGGG + Intergenic
982353486 4:154442532-154442554 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
982705118 4:158700549-158700571 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
982844050 4:160226863-160226885 GTGTGTGTGTGTGGGGGGGTGGG + Intergenic
982932747 4:161429158-161429180 GTGTGTGTGTGTGGCTTGGATGG + Intronic
983379676 4:166976106-166976128 GTGTGTGTGTGTGTGGTGGGTGG - Intronic
983487383 4:168348189-168348211 CTTTGGGAGTCTGGGGTGGGCGG - Intergenic
983827649 4:172284388-172284410 TGGTGTGTGTGGGGGGTGGATGG - Intronic
983919321 4:173328847-173328869 CTTTGGGAGTGTGAGGTGGGAGG - Intergenic
984117444 4:175699642-175699664 ATGTATGTGTGGGGGGTGGAGGG + Intronic
984117828 4:175704355-175704377 TTGTGTGTGTGTGGGGTGGGGGG - Intronic
984349497 4:178571760-178571782 TGGGGTGAGTGTGGGGTGGTTGG + Intergenic
984498440 4:180528959-180528981 TTGTGTGTGGGTAGGGTGGAGGG - Intergenic
984501727 4:180566210-180566232 GGGTGTGAGTGTGGGGGTGAGGG + Intergenic
984521089 4:180801707-180801729 ATGTGTGTGTGTAGGGTGGGGGG + Intergenic
984721501 4:182977484-182977506 GGGTGTGTGTTTGGGGTGGAGGG - Intergenic
984844646 4:184099184-184099206 CTCTGGCAGTGTGGAGTGGAAGG - Intronic
984867319 4:184292875-184292897 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
984992858 4:185397336-185397358 TTGTGTGTGTCTGGGTTGGAGGG - Intronic
985253769 4:188049203-188049225 GTGTGTGTGTGTGTGGTGTAGGG + Intergenic
985445336 4:190018587-190018609 CTGTGTGTGTGTGGGGGGGGTGG + Intergenic
985461794 4:190114239-190114261 CTGTGTCAGTGTGGGGCGATGGG - Intergenic
985465565 4:190191967-190191989 CTGGGTCAGTGTGGGGCGGTGGG - Intergenic
985498091 5:221886-221908 CTCTGTGTGTGTGTGGTGGGGGG + Intronic
985516103 5:345488-345510 ATGTGTGTATGTGGGGGGGAGGG + Intronic
985520230 5:370714-370736 AGGTGACAGTGTGGGGTGGAGGG + Intronic
985956456 5:3269337-3269359 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
985986544 5:3521210-3521232 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
985988483 5:3536681-3536703 CTGTGGGAGTGTGGACGGGAGGG + Intergenic
986428157 5:7655051-7655073 GTTTCTGAGTTTGGGGTGGATGG + Intronic
986437523 5:7748513-7748535 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
986638185 5:9845208-9845230 CTTGGTGCATGTGGGGTGGAGGG - Intergenic
986691055 5:10314284-10314306 CTTTGGGAGGCTGGGGTGGAAGG - Intergenic
986818850 5:11443418-11443440 GTGTGTGTGTGTGGGGTGTGTGG + Intronic
986994148 5:13586943-13586965 CTGTCAGGGGGTGGGGTGGAGGG - Intergenic
987095555 5:14546262-14546284 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
987195876 5:15525598-15525620 CTGTGTGTGTGTGGGGGGTGGGG + Intronic
987303662 5:16618034-16618056 CTGGGTGAGTGTGGGGAGAGAGG + Intergenic
987376428 5:17239542-17239564 CAGGGTGAGTGTGGGGTCAACGG - Intronic
987385438 5:17324810-17324832 GTGTGTGTGTGTGGTGGGGAAGG - Intergenic
987544347 5:19293199-19293221 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
988098606 5:26649670-26649692 CTGTGTATAGGTGGGGTGGAGGG - Intergenic
988268466 5:28983219-28983241 CTGTCTGGGAGTGGGGTGGCAGG - Intergenic
988317953 5:29655926-29655948 GTGTGTGTGTGTGTAGTGGAGGG + Intergenic
988549379 5:32186338-32186360 CTTTGTGAGGCTGGGGTGGAAGG + Intergenic
988643384 5:33066642-33066664 GTGTGTGTGTGTGGGGCGGGGGG + Intergenic
988659745 5:33252440-33252462 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
988917228 5:35906749-35906771 CTGGGGGAGTTTGGGATGGAAGG - Intronic
988937154 5:36095912-36095934 CTTTGGGAGGGTGGGGTGGCTGG - Intergenic
990352289 5:54930956-54930978 CTGTGTGGGTGTGGAGTCAAGGG - Intergenic
990442908 5:55864607-55864629 CTGTGTGTGTGTGGTGTGTATGG - Intronic
990532717 5:56689715-56689737 CTGGGTGAGAGTGGGGAGAAAGG - Intergenic
990552013 5:56891150-56891172 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
991038632 5:62153567-62153589 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
991229507 5:64315499-64315521 CTTTGAGAGTCTGGGGTGGGTGG + Intronic
991515037 5:67425804-67425826 CTGGGTGAGATTGGGGAGGATGG + Intergenic
991997696 5:72404396-72404418 GAGTGTGAGTGTGTTGTGGAGGG + Intergenic
992147772 5:73869206-73869228 GAGTGTGTGTGTGGGGTGGAGGG + Intronic
992299522 5:75364007-75364029 CTGTGTGTGTGTGTGTTGGAAGG + Intergenic
992879625 5:81094075-81094097 CTGAGTGAGAGTGGGTTGAAAGG + Intronic
992996881 5:82343142-82343164 GTGTGTGTGTGTGTGGTGCAGGG + Intronic
993595788 5:89853434-89853456 TGGTGTGAGTGTGGGGTGATGGG - Intergenic
993828351 5:92721961-92721983 GTGTGTGTGTGGGGGGTGGGGGG - Intergenic
993846246 5:92947397-92947419 GTGTGTGTGTGTGGGGCGGGGGG - Intergenic
993924241 5:93845749-93845771 CTGTGTCTGTGTGTGTTGGAGGG + Intronic
994136366 5:96291874-96291896 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
994272127 5:97790533-97790555 GTGTGTGTGTGTGTGCTGGACGG - Intergenic
994376711 5:99023114-99023136 TTGTGTGTGTGTGTGGAGGAAGG + Intergenic
994382173 5:99084572-99084594 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
994382175 5:99084574-99084596 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
995227544 5:109718654-109718676 CAGTATGAGTATGTGGTGGAGGG - Intronic
995397225 5:111699719-111699741 CTTAGTGAGTGTTGGGTGAATGG + Intronic
995416568 5:111919975-111919997 CTTTGTGTGTGTGGGGGGGGGGG - Intronic
995501546 5:112812476-112812498 TTGTGTGTGTGTGGAGAGGAAGG - Intronic
995631582 5:114139457-114139479 GTGTGTGTGTGTGGGGGGGGTGG - Intergenic
995632045 5:114144798-114144820 CTCTGTGAATGTGGGGTGGGGGG + Intergenic
995654413 5:114409009-114409031 CTGTGACAGTGTGGTGGGGAAGG + Intronic
995754822 5:115491620-115491642 GTGTGTGTGTGTTGGGTGGCGGG + Intergenic
995833293 5:116376897-116376919 CTGTGTGGGTGGGGTGTGGATGG + Intronic
996105262 5:119494172-119494194 ATGTGTGATTGGGGGATGGATGG + Intronic
996106519 5:119510936-119510958 CTCTGTAAGTGGGGGCTGGATGG - Intronic
996148149 5:120000588-120000610 TTGTGTGTGTGTGGGGAGGTCGG + Intergenic
996198889 5:120645380-120645402 GTGTGTGTGTGGGGGGGGGATGG - Intronic
996210072 5:120798070-120798092 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
996283181 5:121757068-121757090 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
996374420 5:122789420-122789442 ATGTGTGTGTGTGGTGGGGAAGG - Intronic
996473555 5:123888181-123888203 CTGTGTGAGTGTCTGGGAGAGGG + Intergenic
996757122 5:126946796-126946818 GTCTGTGTGTGTGTGGTGGAGGG + Intronic
996772121 5:127097002-127097024 TTGTGTGTGTGTGGGGGGGGGGG + Intergenic
996832411 5:127754525-127754547 CTGTGTGTGTGTGGGGTGGGGGG - Intergenic
996957577 5:129202573-129202595 CAGTGTGTGTCTGTGGTGGAAGG + Intergenic
997295893 5:132768171-132768193 CTGTGGAAGTGTGGGGTACAGGG + Intronic
997571310 5:134929935-134929957 CTTTGAGAGGGTGGGGTGGGAGG - Intronic
997652590 5:135533618-135533640 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
997692610 5:135836972-135836994 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
997734483 5:136203307-136203329 CTGTGTGTGTGTTGAGTGGGGGG - Intergenic
998164443 5:139834998-139835020 CTGTGTGGGTGACGGGTGAATGG - Intronic
998334405 5:141357944-141357966 CTTTGGGAGTGTGAGGAGGACGG + Intronic
998390454 5:141783990-141784012 CTGTGTGTGTGTCTGGGGGAAGG - Intergenic
998423861 5:142011275-142011297 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
998432622 5:142079395-142079417 GTGTGTGTGTGTGGGGCGGTGGG + Intergenic
998903619 5:146880211-146880233 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
999100200 5:149017515-149017537 GTGTGTGTGTGTGGGGCGGGGGG - Intronic
999133182 5:149299885-149299907 CTGTGTGTGTGTGGAGGGCAGGG - Intronic
999205063 5:149841853-149841875 GAGTGTGAGAGTGGGCTGGAAGG - Intronic
999299443 5:150482074-150482096 CTGTGGGAATGTGGAGGGGAAGG - Intergenic
999347958 5:150840926-150840948 CTGTGTGGGAGTGGGGAGGGTGG + Intergenic
999652216 5:153778644-153778666 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1000067187 5:157704660-157704682 GTGTGTGTGTGTGGTGGGGAAGG + Intergenic
1000107353 5:158072887-158072909 CTGTGTGTGGGTGTGGTGGGGGG + Intergenic
1000227858 5:159285189-159285211 GTGTGTGTGTGTGTGGTGGGAGG - Exonic
1000367368 5:160504326-160504348 GTGTATGTGTGTGGGGTGTAAGG + Intergenic
1000367373 5:160504361-160504383 GTGTATGTGTGTGGGGTGTAAGG + Intergenic
1000613676 5:163404127-163404149 CTTTCTGAATGTGGTGTGGAGGG + Intergenic
1000799235 5:165703870-165703892 GTGTATGTGTGTTGGGTGGAAGG + Intergenic
1001010155 5:168090211-168090233 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1001051190 5:168415787-168415809 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1001179995 5:169511577-169511599 ATGTGTGTGTGTGGAGTGGGGGG - Intergenic
1001198193 5:169692518-169692540 GTGTGTGGGGGTGGGGTGGCGGG + Intronic
1001229603 5:169974834-169974856 ATGTGTGTGTGTCGGGGGGAGGG - Intronic
1001230005 5:169978381-169978403 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1001322376 5:170693248-170693270 ATGTGTGTGTGTCGGGGGGATGG - Intronic
1001398096 5:171430979-171431001 CTGTGTGAGTGTTGCGTGTGTGG + Intronic
1001413742 5:171528748-171528770 GTGTGTGTGTGTTGGGTGGGGGG + Intergenic
1001419199 5:171573957-171573979 CTGGGTCTGTGTGGGGTGGCCGG + Intergenic
1001535968 5:172498068-172498090 CTGTGTTACTGTGGAGAGGAAGG + Intergenic
1001671194 5:173475330-173475352 CTCGGTAAGTGTGGGATGGATGG + Intergenic
1001842801 5:174893506-174893528 GTGTGTGTATGTGTGGTGGAGGG + Intergenic
1001865512 5:175100888-175100910 TTGTATGTGTGTGGGGTGGGGGG - Intergenic
1001939667 5:175731593-175731615 CTGTGTGTGTGTATGGTGGTGGG - Intergenic
1001976477 5:176003996-176004018 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1002058877 5:176614459-176614481 CTCTGTGTGTGGGGGGGGGAGGG + Intergenic
1002172946 5:177385567-177385589 GTGTGTGTGTGTGGTGAGGATGG + Intronic
1002281341 5:178131617-178131639 TGGTGTGAGGGTGGGGCGGAGGG + Intronic
1002375144 5:178783396-178783418 CTGTGTGTGTGTGTGGTGTGTGG - Intergenic
1002591976 5:180296823-180296845 CCGTGTGTGTGTGGGGGGGGGGG - Intergenic
1002712932 5:181205747-181205769 GTGTGTGTGTGTGCGGTGGGGGG - Intergenic
1002745675 5:181469966-181469988 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1002999324 6:2316811-2316833 CTGTGTGTGTGTGTGGAGGGTGG + Intergenic
1003005351 6:2376111-2376133 CTGTGTGTGTGTTGGGTGTAGGG - Intergenic
1004080387 6:12386752-12386774 GTGTGTGTGTGTGGGGGGGGTGG + Intergenic
1004193638 6:13486248-13486270 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1004271795 6:14202210-14202232 CTCTGCGTGTGTGGGGTGGAGGG - Intergenic
1004932049 6:20472019-20472041 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1005154275 6:22785766-22785788 CTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005188198 6:23186549-23186571 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1005258837 6:24034948-24034970 GTGTGTGTGTGTGGAGGGGACGG + Intergenic
1005282102 6:24285029-24285051 GTATGTGTGTGTGGGGGGGAGGG - Intronic
1005396365 6:25386246-25386268 TTGTGTGTGTGTGGGGTGGGTGG + Intronic
1005406151 6:25490080-25490102 CTGAGTGAGAGTGGGCTGGAGGG + Intronic
1005463296 6:26089097-26089119 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1005511619 6:26516937-26516959 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1005730814 6:28695025-28695047 GTGTGTGTGTGTGTGGTGGCGGG - Intergenic
1006119116 6:31793198-31793220 ATTTGTGAGAGTGGGGTGGAGGG - Intronic
1006179599 6:32146879-32146901 CTGTGTGTGTGTCGGGGGAAGGG + Intergenic
1006407476 6:33853557-33853579 CTGAGTGAGTGGTGGGTGCAGGG + Intergenic
1006430584 6:33993324-33993346 CTGAGTGAGTGGGAAGTGGAAGG + Intergenic
1006449302 6:34096757-34096779 GTGAGTGACTGAGGGGTGGAAGG + Intronic
1006517839 6:34554634-34554656 GTCTGTGAGTTTGGGGTGGTGGG + Intronic
1006518501 6:34557619-34557641 TTCTGTGAGAGTGGGGAGGAGGG - Intergenic
1006590092 6:35148678-35148700 TTGTGTGAGGGTGGGGGAGACGG - Intergenic
1006611366 6:35296332-35296354 CTGTGTGATTTGGGGGTGGCTGG - Intergenic
1006710583 6:36065749-36065771 ATGTGTTTGTGTGGGGAGGAAGG - Intronic
1006804176 6:36777759-36777781 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1006808783 6:36806444-36806466 CTCTCTGAGTGGGAGGTGGAGGG - Intronic
1007073375 6:39051881-39051903 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1007073377 6:39051883-39051905 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1007077408 6:39076672-39076694 GTGTGTGAGGGTGTGGTGGGTGG - Intronic
1007208618 6:40172989-40173011 GGGTGTGGGTGTGGGGTGGGGGG - Intergenic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007400147 6:41598711-41598733 CTGGGTGAGTTTGGGGGGCAGGG + Intronic
1007518724 6:42434661-42434683 GTGTGTGTGTGTGTGGTGGAGGG - Intronic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1007696683 6:43738151-43738173 CTGTGTGTGTGTGGTGTGTGTGG + Intergenic
1007698021 6:43746235-43746257 GTGTGTGTGTGTGTGGAGGAGGG + Intergenic
1007701673 6:43769726-43769748 GTGTGTGCGTGTGGGGTTGAGGG + Intergenic
1007709356 6:43811957-43811979 CTCGGTGAGTGTGGGGTGCGTGG + Intergenic
1007769537 6:44181434-44181456 GTGTGTGAGTGTGGTGTGGTTGG - Intronic
1007769838 6:44183812-44183834 CTGGGTGGGGGTGGGGTTGAGGG - Intronic
1007834566 6:44664666-44664688 GTGTGTGTGTGTGGGGCGGGGGG - Intergenic
1008396722 6:51017296-51017318 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1008396724 6:51017298-51017320 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1008544119 6:52570796-52570818 GTGTGTGCGTGTGGGGGGGGGGG - Intronic
1008883884 6:56410935-56410957 ATATGTGTGTGTGGGGTGGGGGG - Intergenic
1009711341 6:67325502-67325524 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1009951570 6:70402936-70402958 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1010570289 6:77466203-77466225 CTGTGGGAGTGCGGGGTGCCAGG + Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1010925860 6:81745168-81745190 GTGTGTGTGTGTTGGGTGCAAGG - Intronic
1010951996 6:82048253-82048275 GTGTGTGAGTGAGGGTTAGAAGG - Intergenic
1011049788 6:83132358-83132380 GTGTGTGTGTGTGTGGCGGAGGG - Intronic
1011344163 6:86350734-86350756 CTGTGTGTGTGTGGTGCGGGTGG - Intergenic
1011891083 6:92160510-92160532 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1012226643 6:96711345-96711367 CTGTTGGGGTGTGGGGTGCAGGG + Intergenic
1012684825 6:102232979-102233001 TTGGGTGAGTGTGGGGTACAAGG - Intergenic
1012997397 6:105986901-105986923 GTGTGTGTGTGTGTAGTGGAAGG - Intergenic
1013339624 6:109200860-109200882 GTGTGTGTGTGTGGGGTGGGGGG + Intergenic
1013734055 6:113205347-113205369 GTGTGTGTGTGTGTGGTGAAGGG + Intergenic
1013905265 6:115209423-115209445 ATGTTTTAGTGTGGGGTGTATGG + Intergenic
1013929115 6:115508977-115508999 GTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1014222205 6:118809217-118809239 CTCAGAGAGTGTGGGGTGGGAGG - Intergenic
1014250231 6:119108139-119108161 GTGTGTGTGTGTGGTGTGTAGGG + Intronic
1014405684 6:121047476-121047498 TTTTGTGATTGTGGGGTGGAGGG - Intergenic
1014740949 6:125147205-125147227 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
1014911925 6:127104855-127104877 GTGTGTGTGTGTGGTGGGGAGGG - Intergenic
1015328589 6:131951367-131951389 TTGTGTGAGTTTGGGGCGGGCGG + Exonic
1015557862 6:134481769-134481791 CTTTTTGAGTGGGGGGAGGAAGG + Intergenic
1015890887 6:137968587-137968609 CTGTGTGAGTGTAGGGAGAGGGG + Intergenic
1015988188 6:138907328-138907350 GTGTGTGTGTGTGGCGGGGAGGG + Intronic
1016209251 6:141507909-141507931 GTGTGTGTGTGTGAGGTGGGGGG + Intergenic
1016329701 6:142944412-142944434 GTGTGTGGGTGTGTGGGGGAGGG - Intronic
1016403327 6:143704109-143704131 GTGTGTGTGTGTGTGGTGGAGGG + Intronic
1016420815 6:143881077-143881099 ATGAGTGGGAGTGGGGTGGAAGG - Intronic
1016452213 6:144195048-144195070 CTGGATGTGTGTGGGGTGGGGGG - Intergenic
1016540093 6:145154682-145154704 CTGTGTGAGTGAGGGTGGGAGGG + Intergenic
1016720799 6:147295442-147295464 GTGTGCGTGTGTGGGGGGGATGG - Intronic
1017007117 6:150036116-150036138 GTGTGGGAGAGTGGGGTGCAGGG + Intergenic
1017048898 6:150372311-150372333 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017048926 6:150372437-150372459 GTGTGTGTGGGTGGGGTGGGGGG + Intronic
1017072221 6:150585770-150585792 CTGAGTGAGTGAGGAGTGAATGG - Intergenic
1017168105 6:151428775-151428797 CTTTGGGAGTCTGGGGTGGGAGG - Intronic
1017362755 6:153595284-153595306 ATGTGTGTGTTTGGGTTGGATGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017447354 6:154518789-154518811 CTGTGGGGGGGTGGGGTGGGGGG - Intergenic
1017458073 6:154621104-154621126 GTGTGTGTGTTTGTGGTGGAAGG - Intergenic
1017903564 6:158739001-158739023 CTGTGTGAGTGGGAGGGGAAAGG - Intronic
1018149872 6:160927424-160927446 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1018676824 6:166229476-166229498 CTGTGTGGGTGGGGGGAGGGAGG + Intergenic
1018840612 6:167514123-167514145 CAGTGTGACTGGGGGGTGGGGGG + Intergenic
1019036756 6:169067317-169067339 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1019250592 6:170743521-170743543 CTGCGTCAGTGTGGGGCGGTGGG - Intergenic
1019552046 7:1608059-1608081 CTGTGTGTGCGAGGCGTGGAGGG + Intergenic
1019903756 7:4044686-4044708 CTTTGGGAGTCTGGGGTGGGAGG - Intronic
1020213044 7:6169757-6169779 CTGGGTTAGTATGGGGTGGAGGG + Intronic
1020370730 7:7429460-7429482 CTGTGTGTGTGTGTGGGGGGGGG + Intronic
1020579900 7:9983939-9983961 TTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1020622649 7:10536368-10536390 CTGTCGGAGGGTGGAGTGGAAGG + Intergenic
1020643311 7:10782565-10782587 CTGTGTGAGGCTGAGGTGGGTGG + Intergenic
1020873579 7:13665852-13665874 TTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1021157995 7:17235793-17235815 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1021322958 7:19234222-19234244 CTGTGTGAGTATGGGGGTGGGGG - Intergenic
1021324495 7:19249078-19249100 CTGGGTGCTTGTGGGGTAGAAGG + Intergenic
1021568299 7:22036662-22036684 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1021639941 7:22727331-22727353 CTGTGTGAGGGAGGGGTGTGTGG + Intronic
1021712709 7:23431820-23431842 ATGTGTGTGTGTGGGTTGGCGGG - Intronic
1021910787 7:25384408-25384430 GTGTGTGTGTGTGTAGTGGAAGG + Intergenic
1022096802 7:27146265-27146287 GTGTGTGTGTCTGGGGTGGGTGG + Intronic
1022127014 7:27368336-27368358 CTGTGTGAGCGTGTGGTGAGTGG - Intergenic
1022244536 7:28545818-28545840 CTGTGTGTGTGTGAAGTGAATGG + Intronic
1022248068 7:28580422-28580444 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1022391403 7:29947575-29947597 CTGCTTGATTGTGGGGAGGAGGG - Intronic
1022684773 7:32586463-32586485 ATGTGTGTGTGTGGGGGGGGGGG - Exonic
1022909360 7:34885218-34885240 CTGAGTGAGGGTGGTGTGGGAGG - Intergenic
1023255705 7:38310452-38310474 CTGGGTGAGTGTGGTGTGGTGGG + Intergenic
1023440037 7:40175986-40176008 CTGTGGGAGGCTGAGGTGGATGG + Intronic
1023517279 7:41014265-41014287 CTGTGTGTGTCTGTGGTGAATGG + Intergenic
1023731604 7:43197314-43197336 CTGTGTGAGTGTGTGGGGGTGGG - Intronic
1024527790 7:50363285-50363307 TTGTGTGCCTGTTGGGTGGAAGG + Intronic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1024967409 7:55036260-55036282 TTGTGTGTGTGTGGGGGGGGGGG + Intronic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025230339 7:57199960-57199982 CTTTGTGAGGCTGAGGTGGATGG + Intergenic
1025837843 7:65112400-65112422 CTTTGGGAGGCTGGGGTGGATGG - Intergenic
1025849775 7:65236491-65236513 GAGTGTGAGTGTGGGGTCCAGGG - Intergenic
1026053815 7:66967923-66967945 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1026647936 7:72188911-72188933 CTTTGTGTGTGTGCGGTGTAGGG - Intronic
1026805613 7:73428497-73428519 GTGTGTGTGTGTTGGGTGGGGGG - Intergenic
1026878640 7:73894215-73894237 CAGGGTGAGGTTGGGGTGGAGGG + Intergenic
1027137861 7:75637983-75638005 ATGTGTGTGTGTGGGGGGGGGGG - Intronic
1027412422 7:77935122-77935144 CTGTGTGTGTGTGTGGGGGGGGG - Intronic
1027828085 7:83142035-83142057 GTGTGTGTGTGTCGGGGGGAGGG - Intronic
1028280522 7:88921127-88921149 AAGGGTGAGTGTGAGGTGGAAGG + Intronic
1028487926 7:91380283-91380305 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1028642173 7:93054595-93054617 CTTTGGGAGGATGGGGTGGAAGG + Intergenic
1028899554 7:96081652-96081674 CTCTGTGAGTGCCTGGTGGATGG + Intronic
1029345588 7:99976255-99976277 TTGTGTGTGCCTGGGGTGGAAGG + Intergenic
1029378141 7:100194541-100194563 CTTTGGGAGAGTGAGGTGGAAGG + Intronic
1029699266 7:102235769-102235791 GTGTGTGTGTGTGGCGGGGACGG - Intronic
1029794671 7:102881564-102881586 GTGTGTGTGTGTGGGGGGGGTGG + Intronic
1030123424 7:106133030-106133052 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1030517308 7:110554027-110554049 TTGTGTGTGTATGGGGTGAAAGG - Intergenic
1030787260 7:113677497-113677519 GTGTGTGTGTGTGAGATGGATGG - Intergenic
1030911141 7:115250970-115250992 TTGTGTGTGTGTGGCGGGGAGGG + Intergenic
1030916945 7:115326871-115326893 CTGTATGAGTGTGGGGATGTGGG + Intergenic
1030927540 7:115477066-115477088 GTGTGGGGGGGTGGGGTGGAGGG + Intergenic
1031052771 7:116961580-116961602 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1031253629 7:119419410-119419432 CTCTGTGTGTGTGTGGTGGGAGG - Intergenic
1031409965 7:121429884-121429906 TTGTGTGTGTGGGGGGGGGAGGG - Intergenic
1031898278 7:127379850-127379872 CTGTGTGTGTGTGGGGGGGGTGG - Intronic
1031941762 7:127797134-127797156 CTGTGGGAGGGTGAGGTGGGTGG - Intronic
1032158732 7:129493214-129493236 GTGTGTGTGTGTGTGGTGGTGGG + Intergenic
1032204170 7:129847281-129847303 CTTTGGGAGTCTGAGGTGGATGG - Intronic
1032483626 7:132266174-132266196 GGGTGTGGGTGTGGGGGGGAGGG + Intronic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1032756568 7:134896589-134896611 CAGTGTGAGTGTGGGTGGGCTGG - Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033129268 7:138731647-138731669 CTTTGGGAGTCTGAGGTGGATGG + Intronic
1033611804 7:142970468-142970490 GTGTGTGTGTGTGTGGTGGGAGG - Intergenic
1033618559 7:143041023-143041045 GTGTGTGTGTGTGTGGTGGGGGG - Intergenic
1033771750 7:144560013-144560035 GTGTGTGTGTGTGTGTTGGAAGG + Intronic
1033898582 7:146107297-146107319 ATGTGCGAGTGTGGGGGGAATGG - Intergenic
1033912964 7:146286860-146286882 CTTTGTGAGGCTGAGGTGGAAGG + Intronic
1034244838 7:149636405-149636427 GAGGGTGAGGGTGGGGTGGATGG - Intergenic
1034416375 7:150966382-150966404 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1034417354 7:150972088-150972110 CTGGGGGAGTGTGGGCTGAAGGG - Intronic
1034438247 7:151073958-151073980 CTCAGTGAGTGTCGGGTGGAAGG - Intronic
1034480090 7:151313161-151313183 ATGTGTGAGTGTGGGTTGTGGGG + Intergenic
1034862543 7:154611865-154611887 GTGTGTGTGTGTGTGGTGTATGG + Intronic
1034968813 7:155407126-155407148 CTGTGGGAGTGTGGGGTGTGGGG + Intergenic
1034968848 7:155407250-155407272 CTGTGGGAGTGTGGGGTGTGGGG + Intergenic
1034968928 7:155407626-155407648 GTGTGTGAGTGTGGAGTGTGGGG + Intergenic
1034968944 7:155407678-155407700 GTGTGGGAGTGTGGGGTGTGGGG + Intergenic
1035284766 7:157799169-157799191 CTGTGTGCTCGTGGGGAGGAAGG + Intronic
1035303547 7:157915451-157915473 GTGTGTGTGTGTGGCGGGGAAGG - Intronic
1035436591 7:158864072-158864094 GTGTGTGTGTGTGGTGTGGGGGG + Intronic
1035513970 8:215783-215805 CTGTGTCAGTGTGGGGCGGTGGG + Intergenic
1035532061 8:360887-360909 CTTTGTGAGGCTGAGGTGGATGG - Intergenic
1035700484 8:1635502-1635524 ATGTGTGCGTGTGTGGTGTATGG + Intronic
1035869700 8:3124132-3124154 CTGTGTGCGTGTGGGGAGGGGGG + Intronic
1036040695 8:5077090-5077112 CTGTGTGTGGGGGGGGTGGGGGG - Intergenic
1036652369 8:10653453-10653475 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1036692235 8:10951287-10951309 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1036753045 8:11455274-11455296 CTGTGTGTGTCTGGGGGGGGTGG + Intronic
1037110549 8:15159750-15159772 CTGTGTGTGTGTGGCGGGGGTGG - Intronic
1037548532 8:19947661-19947683 TTGTGTGTGTGTGGGGCGGGGGG - Intronic
1037670728 8:21013140-21013162 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1038016378 8:23519310-23519332 CTGTGCGAGAATGGGCTGGATGG - Intergenic
1039058674 8:33556459-33556481 CTGTGTGTGTGTGGTGGGCAGGG + Intronic
1039224056 8:35368352-35368374 CTGTGTGTGTGTGGGTGGGTGGG - Intronic
1039364814 8:36918591-36918613 ATGTGTGTGTGTGTGGTGGGGGG - Intronic
1039434011 8:37547275-37547297 GTGTGTGTGTATGGGGTGGGGGG - Intergenic
1039475227 8:37836032-37836054 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1039557741 8:38488726-38488748 GTGTGTGTGTGTGTTGTGGAGGG - Intergenic
1039925827 8:41931568-41931590 GTGTGTGTGTGAGGAGTGGAGGG + Exonic
1040356558 8:46624232-46624254 CTGGGTGGTTGTTGGGTGGATGG - Intergenic
1040582716 8:48710302-48710324 CTGTGTGTGTGTGTGGGGGAGGG + Intergenic
1040792707 8:51251843-51251865 CTGTGTGTCTGTGTGGTGGGGGG + Intergenic
1041484726 8:58362447-58362469 CTTTGTGAGGGTGAGGTGGGTGG - Intergenic
1041516289 8:58702306-58702328 GTGTATGAGTGTGGGGTGATAGG + Intergenic
1041809836 8:61895753-61895775 CTCAGTGTGTGTGGGGTGGCTGG + Intergenic
1042012553 8:64264073-64264095 CTGTGAGAGTGTGTGGTGAAAGG - Intergenic
1042079674 8:65037556-65037578 CAGAGTGTGTGTGGGGTGGGAGG - Intergenic
1042743361 8:72075896-72075918 GTGTGTGTGTGTTGGGTGGAGGG + Intronic
1042803797 8:72749969-72749991 CTCTGTGAGTGTGGGGAGGCAGG - Intronic
1043046664 8:75332612-75332634 CTTTGGGAGGGTGGGGTGGCAGG - Intergenic
1043108717 8:76150380-76150402 CTGTGGGAGGCTGAGGTGGATGG - Intergenic
1043374118 8:79628392-79628414 CTTTGGGAGTCTGAGGTGGACGG - Intronic
1043422322 8:80110960-80110982 CTTTGGGAGGGTGAGGTGGAAGG + Intronic
1043444022 8:80301546-80301568 GTGTGTGTGTGTGTGGTGGTGGG - Intergenic
1043770483 8:84192895-84192917 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1043956368 8:86364560-86364582 CTTTGGGAGTCTGGGGTGGGAGG + Intronic
1044071390 8:87764532-87764554 GTGTGTGTGTGTGTGGTGGAGGG - Intergenic
1044294695 8:90513871-90513893 CTGTCAGAGTGTGGGGTGGGAGG + Intergenic
1044305820 8:90639373-90639395 CTGTGTGTATGTGGGTGGGAGGG - Intronic
1044646494 8:94449193-94449215 CTGTGTGTGTGTGTGGTGGGGGG - Intronic
1045065047 8:98437046-98437068 CTGTGTGTGAGGGGAGTGGAGGG - Intronic
1045305866 8:100956180-100956202 CTGTGGGAGGGTGAGGTGGATGG + Intergenic
1045594534 8:103636791-103636813 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1045739141 8:105334146-105334168 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1045748979 8:105459307-105459329 CTGGGTGTGTGTGTGGTGGCAGG + Intronic
1046297119 8:112234145-112234167 GTGTGTGTGTGTGTGGTGGTGGG - Intronic
1046312711 8:112459347-112459369 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1046507446 8:115154361-115154383 CTGGGTGATGGTGGGGTGGGAGG - Intergenic
1046521791 8:115334476-115334498 CTGGGAGAGTGAGGCGTGGAAGG - Intergenic
1046605692 8:116369245-116369267 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1046808829 8:118510207-118510229 ATGTGTGTGTGTGTGGTGGGGGG - Intronic
1046827460 8:118706952-118706974 CAGTGTGTGTGTGTGGTGTAGGG + Intergenic
1046890357 8:119415853-119415875 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1047097862 8:121642859-121642881 GTGTGTGTGTGTGGCGTGGCGGG - Intergenic
1047141670 8:122147797-122147819 GTGTGTGTGTGTGTGGAGGATGG - Intergenic
1047677150 8:127214789-127214811 GTGTGTGTATGTGGGGTGTATGG + Intergenic
1047718650 8:127618919-127618941 CTGTGTGTGTTTGGGGTGAGGGG + Intergenic
1048292975 8:133194467-133194489 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1048301949 8:133258218-133258240 GTGTGTGTGTGTGTGGTGCATGG - Intronic
1048525512 8:135198833-135198855 CTGACTGAGTGTGGGGAGGATGG - Intergenic
1048698507 8:137056653-137056675 ATGTGTGTGTTTGGGGTGGGAGG - Intergenic
1048882505 8:138882456-138882478 GTGTATGAGTGTGAGGTGTAGGG - Intronic
1049039609 8:140102466-140102488 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1049159597 8:141088900-141088922 CTGGGTACATGTGGGGTGGATGG + Intergenic
1049167073 8:141133120-141133142 CAGTGAGCGTGGGGGGTGGAGGG + Intronic
1049225965 8:141450639-141450661 GGGTCTGAGTGTTGGGTGGAAGG + Intergenic
1049298063 8:141854501-141854523 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1049320365 8:141993009-141993031 CTGTGCATATGTGGGGTGGAAGG - Intergenic
1049447403 8:142637719-142637741 CTTTGGGAGTCTGGGGTGGGTGG - Intergenic
1049570205 8:143366502-143366524 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1049575112 8:143386298-143386320 CTGTGGGAGGGTGCGGTGGGAGG - Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049718819 8:144106238-144106260 CTGGGTGAGGGTCAGGTGGAGGG + Exonic
1049775004 8:144400078-144400100 CTGGGTGCCTGTGGGGTGGGTGG + Exonic
1049775027 8:144400147-144400169 CTTCGTGAGTGTGGGGTGGCTGG - Exonic
1049805541 8:144537167-144537189 GTGTGAGAGTGTGGGTGGGAAGG + Intronic
1049908668 9:244269-244291 GTGTGTGTGTGTGTGGTGGGGGG - Intronic
1050131988 9:2422432-2422454 CTGTGTCAGGGAGGGCTGGAAGG + Intergenic
1050186949 9:2984703-2984725 CTGTGGGAGAGTGAGGAGGAAGG + Intergenic
1050534732 9:6622139-6622161 GTCTGTGTGTGTGTGGTGGAGGG - Intronic
1050596014 9:7205359-7205381 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1050619248 9:7435278-7435300 CTCAGTGGGTGTGGGGAGGAGGG - Intergenic
1050651855 9:7785319-7785341 GTGTGTGTGTGTGGGGCGGGGGG - Intergenic
1051096029 9:13466050-13466072 CTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1051213113 9:14766362-14766384 CTGCCTGTGTGTGGGGTGGCAGG + Intronic
1051969745 9:22874076-22874098 CTTTGTGAGTCTGGGGCAGAAGG + Intergenic
1052203069 9:25805889-25805911 ATGTGTGAGTGACGGGTTGAGGG + Intergenic
1052206610 9:25848718-25848740 GTGTGTGTGTGTGGGGTTGGGGG - Intergenic
1052209864 9:25891582-25891604 AGGTGTGAGTGTGGAGGGGAGGG - Intergenic
1052328877 9:27246952-27246974 TTGTGTGTGTGTGGGGTGGGGGG - Intergenic
1052340414 9:27359367-27359389 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1052513190 9:29447798-29447820 TTGTGTGAGTGTTGAGTGGCTGG + Intergenic
1052567711 9:30178942-30178964 CTGTGTTAGTCTGGGAGGGAAGG + Intergenic
1052911123 9:33882843-33882865 CTTTGGGAGTCTGAGGTGGACGG + Intronic
1053272410 9:36759390-36759412 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1053507826 9:38659814-38659836 CTGTGTCAGTTTGGGGAGGAAGG + Intergenic
1054246885 9:62675584-62675606 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1054561005 9:66710116-66710138 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1055043320 9:71898877-71898899 CTTTGCGAGTCTGAGGTGGATGG + Intronic
1055403592 9:75950133-75950155 GTGTGTGTGTGTGGGGGGGGCGG + Intronic
1055410251 9:76021353-76021375 GTGTGTGGGTGTGGGTTGGGGGG + Intronic
1056068124 9:82958208-82958230 GTGTGTGTGTGTGGGGGGGGTGG - Intergenic
1056193394 9:84206398-84206420 TTGTGTGTGTGGGGGGTGGTTGG + Intergenic
1056232040 9:84556954-84556976 GTGTGTGTGTGTGTGTTGGAAGG + Intergenic
1056561500 9:87733866-87733888 CTGTGTGACTGAGAGGTGCATGG - Intergenic
1056573653 9:87837905-87837927 CTGTGTGTTTGTGTGGTGGGAGG - Intergenic
1056575754 9:87855306-87855328 ATGTGTGTGTGTGTGTTGGAGGG - Intergenic
1056640499 9:88365967-88365989 CTGTGGAAGTGTGAGGTGGGTGG - Intergenic
1056740836 9:89253837-89253859 ATGTGTGAGTGTGGTGTGTGTGG + Intergenic
1056781073 9:89551539-89551561 CTGTGTGTGCGTGGGGTGGGGGG - Intergenic
1056859361 9:90165496-90165518 GTGTGTGTGTGTGGTGTGGTAGG + Intergenic
1056884172 9:90424113-90424135 GTGTGTGAGTGTGCAGTGAAGGG - Intergenic
1057074884 9:92133417-92133439 GTGTGTGTGTGTGTGGTGGGGGG + Intergenic
1057123079 9:92594709-92594731 CTTTGGGAGGCTGGGGTGGAGGG + Intronic
1057439308 9:95071283-95071305 GTGTGTGTGTGTGGGGCGGGGGG - Intronic
1057747905 9:97766423-97766445 CTCTGTGAGTTGGAGGTGGAGGG + Intergenic
1057887991 9:98845666-98845688 CTGTGTTGGTGTGGGATGGGAGG - Intronic
1058099732 9:100905684-100905706 CTCTGTGTGTGTGGGGGGGGGGG + Intergenic
1058099734 9:100905686-100905708 CTGTGTGTGTGGGGGGGGGGGGG + Intergenic
1058187429 9:101871419-101871441 CTGTGGGAGTCGGGGGTGGTGGG - Intergenic
1058622611 9:106899228-106899250 GTGTGTGTGTGTGGGGGGGGGGG + Intronic
1059023694 9:110602442-110602464 CTGTGTGGGTGAGGGGTAGAAGG - Intergenic
1059161293 9:112037744-112037766 ATGTGTGTGTGTGTGGTGGGTGG - Intergenic
1059175890 9:112169916-112169938 CTTTGGGAGATTGGGGTGGATGG - Intronic
1059206242 9:112468881-112468903 ATGTGTGTGAGTGGGGTGGGTGG + Intronic
1059718062 9:116932005-116932027 CTGTGAGAATGAGGGGTGGTAGG + Intronic
1059911439 9:119048731-119048753 CTGTGTGTGTGTCGGGGGGTGGG - Intergenic
1059935176 9:119303269-119303291 CTGTGTGTGTGTGGTGGGGGTGG - Intronic
1060508793 9:124217242-124217264 GTGTGTGTGTGTGTGGTGGGTGG - Intergenic
1060584838 9:124779531-124779553 TTGTGTGTGTGTGTGGTGGGGGG + Intronic
1060649757 9:125315253-125315275 TTGTGTGTGTGTGTGGAGGATGG - Intronic
1060920762 9:127418846-127418868 CTCTGGGAGTGTGGTCTGGAAGG - Intergenic
1061318144 9:129810339-129810361 GTGTGTGTGTGTGGGGGGGTGGG + Exonic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062106842 9:134759849-134759871 ATGTGTGAGTGTGGGGGTGTGGG - Intronic
1062106865 9:134759989-134760011 GTGTATGAGTGTGGGGTGTGTGG - Intronic
1062296859 9:135835232-135835254 CTGTGTGTGTGGGGGCGGGAGGG - Intronic
1062446736 9:136598380-136598402 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062446811 9:136598650-136598672 CTGGGGGAGTGTGGGCAGGAGGG + Intergenic
1062491277 9:136806265-136806287 CTTTGTGAGACTGGGGTGGGTGG - Intronic
1062559143 9:137131702-137131724 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1062572328 9:137191386-137191408 CTCTGGGAGGCTGGGGTGGAGGG + Intergenic
1062629222 9:137456196-137456218 CTGTGTGTGTGTGGGGGGGGGGG + Intronic
1062736445 9:138140189-138140211 ATGTGTGAGTGTGTGGTGGGTGG + Intergenic
1203365024 Un_KI270442v1:249116-249138 CTGTGTGGGGGTGCGGGGGAAGG - Intergenic
1203580147 Un_KI270745v1:36118-36140 CTGTGTCAGTGTGGGGCGGTGGG - Intergenic
1203655961 Un_KI270752v1:25056-25078 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1185527367 X:790261-790283 CTGTGTGTGTGTGTGGGGGGGGG + Intergenic
1185527369 X:790263-790285 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1185547812 X:959679-959701 CTGAGTGAGGGAGGGGGGGAAGG - Intergenic
1185650277 X:1642507-1642529 CTGTGTGTGTGTGATGGGGACGG + Intronic
1185709722 X:2293805-2293827 CAGTGTGTGTGTGTGGTGGGGGG + Intronic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186109956 X:6245186-6245208 GTGTGTGTGTGTGGGTTGGTGGG + Intergenic
1186439269 X:9571234-9571256 CTGTGTATGGGTGGGGTGGAGGG + Intronic
1186613995 X:11167337-11167359 GTGTGTGTGTGTGTGATGGAGGG + Intronic
1186786640 X:12962201-12962223 TTATGGGAGTGTGGGATGGATGG - Intergenic
1187423891 X:19160211-19160233 CTGTCTGACTGGGGGGTGGTGGG + Intergenic
1187496460 X:19799832-19799854 CAGTGTGAGTGTGTAGTGGGAGG - Intronic
1187648166 X:21373151-21373173 GTGTGTGTGTGTGGGGGGGAAGG + Intergenic
1187754063 X:22500582-22500604 GTGTGTGTGTGTGGGGGGGGAGG + Intergenic
1187879484 X:23833255-23833277 GTGTGTGTGTGTGGTATGGATGG - Intergenic
1188412573 X:29891915-29891937 CTGTGAGAGTATGGGGTACATGG - Intronic
1189065295 X:37801644-37801666 CTGTGTGTTTGTGGAGGGGAAGG + Intronic
1189185217 X:39049001-39049023 GTGTGTGTGTGTGTGGTAGAAGG - Intergenic
1189578359 X:42379858-42379880 ATGTGTGTGTGTGGGTTGGGGGG - Intergenic
1189579612 X:42392278-42392300 GTGTGTGTGTGTGGAGGGGAGGG + Intergenic
1189582301 X:42419755-42419777 ATGTGTGTGTGTGTGGTGGTGGG + Intergenic
1189921943 X:45910861-45910883 CTGTGTGTGTGGGGAGGGGAGGG + Intergenic
1190009810 X:46774750-46774772 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1190103425 X:47540924-47540946 CTGTGTGAGGCTGAGGTGGGTGG - Intergenic
1190106525 X:47564896-47564918 TTTTGTGAGTGCAGGGTGGACGG + Exonic
1190193901 X:48300611-48300633 CTTTGGGAGGCTGGGGTGGATGG - Intergenic
1192541885 X:71980546-71980568 GTGTGTGTGTGTGGGGTGTGTGG + Intergenic
1192828934 X:74729918-74729940 GTGTGTGTGTTTGGGGTGGGGGG + Intergenic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1192856141 X:75014367-75014389 CTGTCAGAGGGTGGGTTGGAGGG - Intergenic
1193274933 X:79574679-79574701 GTGTGTGTGTGTGTGTTGGAGGG - Intergenic
1193447664 X:81623997-81624019 TTGTGTGTGTGTGGGTGGGAGGG + Intergenic
1194064579 X:89245904-89245926 CTTTGTGAGTCTGAGGTGGGTGG + Intergenic
1194235677 X:91380816-91380838 CTGTGTGTGCGTGGGGGGGGGGG - Intergenic
1194424518 X:93720034-93720056 GTGTGTGTGTGTGTGGTGGGTGG + Intergenic
1194988688 X:100520775-100520797 TTGTGTGTGTGTGTTGTGGAGGG + Intergenic
1195176924 X:102321246-102321268 ATGTGTGTGTGTGGGGGGGGTGG - Intronic
1195181940 X:102365847-102365869 ATGTGTGTGTGTGGGGGGGGTGG + Intronic
1195273732 X:103257816-103257838 GTGTGTGTGTTGGGGGTGGAGGG + Intergenic
1195280093 X:103324015-103324037 CTGTGTCAGTTTTGAGTGGATGG - Intergenic
1195438668 X:104875733-104875755 CTGTATGTGTGTAAGGTGGATGG - Intronic
1195545257 X:106106292-106106314 CTCTGTTAGGGTGGTGTGGAAGG + Intergenic
1195600019 X:106735900-106735922 GTGTGTGTGTGTTGGGGGGAGGG - Intronic
1195614144 X:106899722-106899744 CTGTGTGCATGTGGGGAGGAGGG - Intronic
1195756134 X:108200594-108200616 TGGTGTGAGTGTGGGGTGGGGGG + Intronic
1195862971 X:109400703-109400725 GGGTGTGAGTGAGTGGTGGATGG - Intronic
1196189951 X:112783707-112783729 GTGTGTGTGTGTGTGGTGGGCGG + Intronic
1196387497 X:115174592-115174614 GTGTGTGTGTGTGGGGGGGGGGG - Intronic
1196387862 X:115177790-115177812 CTGTGGGGGTGTGGGGGGCAAGG - Intronic
1196410119 X:115409813-115409835 CAGGGAGAGTGTGGTGTGGAGGG - Intergenic
1196609410 X:117694839-117694861 TGGTGTGTGTGTGGGGGGGAGGG - Intergenic
1196761572 X:119205449-119205471 GTGTGTGGGTGAGGGGAGGAGGG + Intergenic
1196856611 X:119990873-119990895 GTGTGTGTGTGTGTGGCGGAAGG - Intergenic
1196857825 X:120000274-120000296 GTGTGTGTGTGTGTGGCGGACGG + Intergenic
1197274493 X:124462420-124462442 GTGTGTGTGTGTGGGGGGGGTGG + Intronic
1197293828 X:124692761-124692783 CTTTGGGAGTCTGAGGTGGACGG + Intronic
1197433208 X:126391987-126392009 CTGTCAGGGTGTGGGGTGGGGGG + Intergenic
1197571412 X:128155558-128155580 CTGTTTCAGTGTGGGATGGCTGG + Intergenic
1197614978 X:128680853-128680875 CTGTGTGTGTGTTTGGGGGATGG - Intergenic
1197977356 X:132180055-132180077 CTGTCAGAGGGTGGGGTGGGGGG + Intergenic
1198025545 X:132702794-132702816 GTGTGTGTGTGTGTGTTGGAGGG - Intronic
1198218402 X:134577773-134577795 GTGTGTGTGTGTGTAGTGGAGGG + Intronic
1198226117 X:134647436-134647458 GTGTGTGTGTGTGTGTTGGAGGG + Intronic
1198602071 X:138294891-138294913 TTGTGTGTGTGTGGTGTGGAGGG - Intergenic
1199053055 X:143260065-143260087 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1199161217 X:144614328-144614350 GTGTGTGTGTATGGGGTGGTGGG + Intergenic
1199165797 X:144673475-144673497 CCTTGTGAGTGAGAGGTGGAGGG - Intergenic
1199307750 X:146287429-146287451 ATGTGTGAGTGTGTGGTTGTGGG - Intergenic
1199370225 X:147039211-147039233 TTGTGTGTGTGTGGGAGGGAGGG - Intergenic
1199387007 X:147234676-147234698 GTGTGTGTGTGTGGGGGGGGGGG - Intergenic
1199435098 X:147804244-147804266 GTGTGTGAGTGAGGGGTGGGTGG + Intergenic
1199845387 X:151689026-151689048 CTGTGTGTGTGTGGGTGGGGGGG - Intergenic
1199991243 X:152988784-152988806 CTGTGTGAAACTGGGGTGGGAGG - Intergenic
1200009903 X:153113055-153113077 CTGTGGGAGGCTGGGGTGGGAGG + Intergenic
1200029697 X:153286867-153286889 CTGTGGGAGGCTGGGGTGGGAGG - Intergenic
1200043922 X:153389718-153389740 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200044119 X:153391921-153391943 GTGTGTGTGTGTGGTGTGCATGG - Intergenic
1200044128 X:153392020-153392042 GTGTGCGAGTGTGGTGTGCATGG - Intergenic
1200106373 X:153715523-153715545 CCTTGTGAGTGGGGGGTTGAGGG - Exonic
1200258818 X:154600725-154600747 GTGTGTGTGTGTGTGGTGGCGGG + Intergenic
1200280199 X:154770697-154770719 TGGTGTGGGAGTGGGGTGGAGGG + Intronic
1200398683 X:156006278-156006300 ATGTGTGAGTGTGTGGTGGGTGG + Intronic
1200718750 Y:6579982-6580004 CTTTGTGAGTCTGAGGTGGGTGG + Intergenic
1200860761 Y:7989266-7989288 CTGTGTGTGTGTAGTGGGGATGG - Intergenic
1201073155 Y:10168535-10168557 CTGGCTGAGGGTGGGGAGGAGGG + Intergenic
1201490879 Y:14540110-14540132 GTGTGTGTGTGTGTGGTGGGGGG + Intronic
1201538626 Y:15080976-15080998 GTGTGTGTGTGTGGGGGGGGGGG + Intergenic
1201609986 Y:15830479-15830501 CTTTGGGAGTCTGGGGTGGGTGG - Intergenic
1201710142 Y:16982303-16982325 CTGTGTGTGTGTGGTTTGTATGG + Intergenic
1201789646 Y:17825416-17825438 CTGTGTGTGTGTGGAGCGGGTGG - Intergenic
1201811908 Y:18080573-18080595 CTGTGTGTGTGTGGAGCGGGTGG + Intergenic
1202351297 Y:23995166-23995188 CTGTGTGTGTGTGGAGCGGGTGG - Intergenic
1202519482 Y:25674953-25674975 CTGTGTGTGTGTGGAGCGGGTGG + Intergenic