ID: 1163258749

View in Genome Browser
Species Human (GRCh38)
Location 19:16173742-16173764
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258749_1163258755 5 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258755 19:16173770-16173792 GGCACACTCAAGAGACAGGCAGG No data
1163258749_1163258759 24 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG No data
1163258749_1163258757 17 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258757 19:16173782-16173804 AGACAGGCAGGGTATACAGAAGG No data
1163258749_1163258754 1 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258754 19:16173766-16173788 ATGGGGCACACTCAAGAGACAGG No data
1163258749_1163258758 18 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258758 19:16173783-16173805 GACAGGCAGGGTATACAGAAGGG No data
1163258749_1163258760 25 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258760 19:16173790-16173812 AGGGTATACAGAAGGGCTATGGG No data
1163258749_1163258756 6 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258756 19:16173771-16173793 GCACACTCAAGAGACAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258749 Original CRISPR ACCCCAGCCTCACCTTGTGG TGG (reversed) Intergenic
No off target data available for this crispr