ID: 1163258750

View in Genome Browser
Species Human (GRCh38)
Location 19:16173745-16173767
Sequence ATAACCCCAGCCTCACCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258750_1163258758 15 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258758 19:16173783-16173805 GACAGGCAGGGTATACAGAAGGG No data
1163258750_1163258759 21 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG No data
1163258750_1163258757 14 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258757 19:16173782-16173804 AGACAGGCAGGGTATACAGAAGG No data
1163258750_1163258755 2 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258755 19:16173770-16173792 GGCACACTCAAGAGACAGGCAGG No data
1163258750_1163258756 3 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258756 19:16173771-16173793 GCACACTCAAGAGACAGGCAGGG No data
1163258750_1163258760 22 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258760 19:16173790-16173812 AGGGTATACAGAAGGGCTATGGG No data
1163258750_1163258754 -2 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258754 19:16173766-16173788 ATGGGGCACACTCAAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258750 Original CRISPR ATAACCCCAGCCTCACCTTG TGG (reversed) Intergenic
No off target data available for this crispr