ID: 1163258759

View in Genome Browser
Species Human (GRCh38)
Location 19:16173789-16173811
Sequence CAGGGTATACAGAAGGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258749_1163258759 24 Left 1163258749 19:16173742-16173764 CCACCACAAGGTGAGGCTGGGGT No data
Right 1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG No data
1163258750_1163258759 21 Left 1163258750 19:16173745-16173767 CCACAAGGTGAGGCTGGGGTTAT No data
Right 1163258759 19:16173789-16173811 CAGGGTATACAGAAGGGCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258759 Original CRISPR CAGGGTATACAGAAGGGCTA TGG Intergenic
No off target data available for this crispr