ID: 1163258962

View in Genome Browser
Species Human (GRCh38)
Location 19:16175182-16175204
Sequence AGGCCAGGTAGAGAAAACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163258962_1163258968 17 Left 1163258962 19:16175182-16175204 CCTGTGTTTTCTCTACCTGGCCT No data
Right 1163258968 19:16175222-16175244 CCCAGCAGGCTTTCCTGCCTCGG No data
1163258962_1163258966 3 Left 1163258962 19:16175182-16175204 CCTGTGTTTTCTCTACCTGGCCT No data
Right 1163258966 19:16175208-16175230 CTATTGCAATGTTTCCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163258962 Original CRISPR AGGCCAGGTAGAGAAAACAC AGG (reversed) Intergenic
No off target data available for this crispr