ID: 1163260333

View in Genome Browser
Species Human (GRCh38)
Location 19:16185768-16185790
Sequence GAGCAGAAGCAGAAGGCGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 429}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163260323_1163260333 18 Left 1163260323 19:16185727-16185749 CCGGCCCAGGCGGCCTTCGAGAA 0: 1
1: 0
2: 1
3: 2
4: 84
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429
1163260327_1163260333 5 Left 1163260327 19:16185740-16185762 CCTTCGAGAAAATGCAGGAGAAG 0: 1
1: 1
2: 4
3: 23
4: 217
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429
1163260324_1163260333 14 Left 1163260324 19:16185731-16185753 CCCAGGCGGCCTTCGAGAAAATG 0: 1
1: 0
2: 0
3: 3
4: 48
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429
1163260322_1163260333 19 Left 1163260322 19:16185726-16185748 CCCGGCCCAGGCGGCCTTCGAGA 0: 1
1: 0
2: 0
3: 7
4: 127
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429
1163260321_1163260333 20 Left 1163260321 19:16185725-16185747 CCCCGGCCCAGGCGGCCTTCGAG 0: 1
1: 0
2: 0
3: 17
4: 122
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429
1163260325_1163260333 13 Left 1163260325 19:16185732-16185754 CCAGGCGGCCTTCGAGAAAATGC 0: 1
1: 0
2: 0
3: 4
4: 86
Right 1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163260333 Original CRISPR GAGCAGAAGCAGAAGGCGGC GGG Intronic
900125199 1:1065837-1065859 AAGCAGAGAGAGAAGGCGGCAGG + Intergenic
900600396 1:3500304-3500326 GAGCCGCAGCAGGAGGGGGCAGG - Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901056798 1:6452082-6452104 GAGCAGAGGCGGAAGGTGGGTGG + Exonic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901497880 1:9632484-9632506 CAGCAGAAACAGAGGGCAGCTGG - Intergenic
901604731 1:10450237-10450259 GAGCAGCAGCAGCAGGAGGCCGG - Exonic
901727369 1:11252627-11252649 GTGCAGAAGCAGGAGGAGTCTGG - Intronic
901922592 1:12547694-12547716 GAGCAGAAGCACAGGGCCGCGGG - Intergenic
902721940 1:18309688-18309710 GGGCAGAGGCAAAAGGAGGCCGG - Intronic
902965787 1:20001012-20001034 GAGCTGAAGTATAAGGCGTCTGG - Intergenic
903545312 1:24120306-24120328 GAAAAGAACCAGAAGGAGGCTGG - Exonic
903548223 1:24140559-24140581 TAACAGAAGCAGAAGTGGGCTGG - Intronic
903694892 1:25199390-25199412 GTGCAGAAGGAGAAGGTGGGAGG + Intergenic
903749373 1:25611234-25611256 CAGCAGAAGCAGCAGTCAGCTGG - Intergenic
905345160 1:37306300-37306322 GTGAAGAAGCAGATGGCAGCCGG - Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906124443 1:43418838-43418860 GAGCAGCAGCAGGAGGAGGGTGG + Intronic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906239242 1:44231669-44231691 GAGCAGAAGCAGGTGGCTGTTGG - Intronic
906262523 1:44405367-44405389 CAGCAGCAGCAGTAGGCGGCTGG - Exonic
906646579 1:47479393-47479415 GAGGAGAAGGACAAGGCAGCGGG - Intergenic
907826473 1:58021896-58021918 GTTCAGAAGCAGAAGGGGGTTGG + Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908605123 1:65790448-65790470 GAGCAGAAGCAGAAGGAAGAAGG - Intergenic
911096179 1:94056864-94056886 GGGCAGAATGAGAAGGCGTCCGG - Intronic
911136724 1:94448510-94448532 GAGCTGAAGTATAAGGCGTCTGG - Intronic
911824842 1:102469372-102469394 GAGCAGAAGAGGAAGGCAGATGG + Intergenic
913231275 1:116742506-116742528 CAGCACAAGCAGAAGGCGCTCGG - Intergenic
913961326 1:143339920-143339942 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914055679 1:144165493-144165515 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
914123467 1:144800869-144800891 GTGCAGAGGCAGCAGGTGGCAGG - Intergenic
915367786 1:155325170-155325192 GTGCAGAAGGTGAAGGTGGCTGG + Exonic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
916168144 1:161981445-161981467 GAGCAGAAACGGAAGGCAGAGGG - Intergenic
916412306 1:164558902-164558924 GAGGAGGAGCTGAAGGAGGCTGG + Intronic
916797512 1:168180328-168180350 GAGGAGAAGCAGATGGGGGCAGG + Intronic
917616732 1:176753469-176753491 GAGCAGAGGAAGAAGAAGGCTGG - Intronic
919844882 1:201635774-201635796 GAGCTGAAGCAGATCGCTGCAGG - Intronic
921298184 1:213724025-213724047 GAGCAGAAGCAGGATGCAGTAGG + Intergenic
921734505 1:218612007-218612029 GAGGAGAAGGAGAAGGGGGTAGG - Intergenic
922618994 1:226979314-226979336 GTTCACAGGCAGAAGGCGGCAGG - Intronic
922709378 1:227815760-227815782 GAGCAGCAGCAGAAGGCCCAGGG - Exonic
922934178 1:229411045-229411067 GAGCAGCAGCTGAAAGCGCCTGG + Intergenic
923072368 1:230577640-230577662 GAGGAGAAGAAGAAGGAGGAAGG - Intergenic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923344839 1:233041648-233041670 GAGCAGCAGCAGACAGCTGCAGG - Intronic
923503462 1:234585539-234585561 GAGCAAAAGCAGAGGGTGGCAGG - Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
924082697 1:240415940-240415962 GAATAGAAGCTGAAGGAGGCTGG - Intronic
924425192 1:243944149-243944171 GAACAGAAGGAAAAGGCAGCCGG + Intergenic
924442989 1:244102368-244102390 GTGCAGAAGGAGAATGCTGCTGG - Intergenic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1062911167 10:1213412-1213434 TACCAGAACCAGAAGGTGGCTGG + Intronic
1063069748 10:2649357-2649379 GAGCAAAAGCAGCCGGCGGGAGG - Intergenic
1063495221 10:6501470-6501492 GAGCAGGAGGAGAAGGCGGGAGG + Intronic
1064102797 10:12477731-12477753 GGGAAGAAGCTGAAGGCGGAGGG + Intronic
1065659803 10:27994288-27994310 GGCTAGAAGCAGGAGGCGGCGGG - Intronic
1065683769 10:28263738-28263760 GAGCTGCAGCTGAAGGCGCCAGG + Intronic
1065967178 10:30779802-30779824 GAGAGGAAGCACAAGGAGGCAGG - Intergenic
1067029777 10:42872318-42872340 GTGCAGAGGCAGCAGGCGGCAGG + Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067224153 10:44364496-44364518 GAGCAGCAGCAAGAGGAGGCCGG + Intergenic
1070759132 10:79012579-79012601 CAGGAGATGCAAAAGGCGGCTGG - Intergenic
1070804475 10:79262989-79263011 CAGCAGAAGCAGCTGACGGCTGG - Intronic
1071676410 10:87659796-87659818 GAGGAGTAGGAGAAGGGGGCTGG + Exonic
1072092093 10:92138422-92138444 GAGGAGCAGCAGGAGGCGGAAGG + Intronic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072753254 10:97999452-97999474 GGGAAGAGGCAGCAGGCGGCTGG - Intronic
1073340929 10:102744035-102744057 GAGCAGGAGCAGGAGGGGGATGG + Exonic
1073452740 10:103619272-103619294 GAGCAGAACCAGGAGCAGGCAGG - Intronic
1074217054 10:111395234-111395256 GAGCAGAAGGAGAAGAGGGAGGG + Intergenic
1074532230 10:114305573-114305595 GCGCAGATGCAGGAGGCGACGGG + Intronic
1074765877 10:116699644-116699666 CACCAGGAGCAGAAGGCAGCTGG - Intronic
1075330149 10:121568122-121568144 GAGAAGGAGGAGAAGACGGCAGG + Intronic
1075488786 10:122848455-122848477 GAGCTGGAACAGAAGGCAGCTGG + Intronic
1075682483 10:124342581-124342603 CAGCAGAAGCAGATGGCCTCAGG + Intergenic
1076053009 10:127350276-127350298 GAGCAGAGGCTGCAGGAGGCAGG - Intronic
1076137512 10:128055264-128055286 GAGCAGACGCAGGAGACAGCTGG + Intronic
1076228818 10:128803042-128803064 GAGCAGATGTAGAAGGCAGGAGG + Intergenic
1077483268 11:2826522-2826544 AAGCAGCAGCAGGAGGGGGCGGG - Intronic
1077912665 11:6586903-6586925 GAGCCGAGGCAGCAGGAGGCTGG - Intronic
1078135795 11:8650450-8650472 GAGCAGAAGGAAAAGGAGGAAGG + Intronic
1078413780 11:11148860-11148882 GGGGAGAAGCAGAATGAGGCAGG - Intergenic
1078468146 11:11565524-11565546 GAGCAGAAGAAAAAGGAGGCTGG + Intronic
1079138945 11:17794965-17794987 CAGCAGATGCAGAAGGGGGCAGG - Intronic
1079392703 11:20036217-20036239 GAGCAGAGGCGGCAGGAGGCTGG - Intronic
1079889130 11:26028439-26028461 TACCAGGAGCAGAAGGTGGCAGG + Intergenic
1080896465 11:36452496-36452518 GAGAAGAACCAGCAGGCAGCAGG - Intronic
1081165975 11:39809813-39809835 GAGCACAAGCAGAAGCAGGGTGG + Intergenic
1081193726 11:40135978-40136000 GAGCAGAACTAGAAGAGGGCTGG + Intronic
1083611783 11:64007827-64007849 GCTCAGAAGCAGCAGGCAGCCGG - Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084639283 11:70414823-70414845 GAGAGGAAGCAGGATGCGGCGGG + Intronic
1085202061 11:74707803-74707825 GAGCAGAGGCAGGAGTGGGCTGG - Intronic
1088109477 11:106245788-106245810 GAGCAGAAGCAAAATGGGGGAGG - Intergenic
1089128456 11:116193720-116193742 GGGAAGCAGCAGAAGACGGCGGG - Intergenic
1089579326 11:119471518-119471540 GATCAGAGGCAGCAGGGGGCCGG + Intergenic
1089868521 11:121652297-121652319 GTGCAGAAGCAGAAGTCAGAAGG + Intergenic
1090163293 11:124518068-124518090 AAGCAGAAGCAGAGGGTGTCTGG - Intergenic
1090234340 11:125136196-125136218 GAGCAGAAGCAGAAGTGGAGAGG - Intergenic
1090519075 11:127459531-127459553 GAGCTGGAGCAGAAGCAGGCTGG - Intergenic
1091215056 11:133895971-133895993 GAGCAAAAGCAGAAAGGGGGTGG - Intergenic
1091283687 11:134396503-134396525 TAGCAGAGGCAGAAAGAGGCTGG - Intronic
1091398920 12:171198-171220 GAGAAGAAGAACAAGGGGGCAGG - Intronic
1091449288 12:562526-562548 GAGCAGGATAAGAAGGGGGCGGG + Exonic
1091509959 12:1112263-1112285 GAGCTGAAAAAGAAAGCGGCTGG + Exonic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092238051 12:6821989-6822011 GGGCAGAAACAGCAGGTGGCTGG - Intronic
1092945407 12:13449815-13449837 GGGCAGAGGCAGAAGGGGGTGGG - Intergenic
1092958069 12:13568624-13568646 GATCAGAAGCAGAAGACCACAGG - Intronic
1093125441 12:15322758-15322780 GAGCAGAGGCAGGAGGCGGCGGG - Exonic
1093368686 12:18337614-18337636 GAGCTGGAGCAGAGGGAGGCGGG + Intronic
1094771307 12:33663174-33663196 GACCAGAACCATAAGGGGGCGGG + Intergenic
1095998136 12:48106362-48106384 GGGCGGAACCAGAAGGCGGCGGG - Intronic
1096489811 12:52007275-52007297 GAGCAGATCCTGAAGGCGGGCGG - Intronic
1096717353 12:53499491-53499513 GAGGAGAAGGAGGAGGAGGCGGG - Intronic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099842230 12:87980730-87980752 GGGCAGAAGCTGAAGGCAACTGG - Intronic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101902461 12:108800685-108800707 CTGCAGATGCAGAAGTCGGCTGG - Intronic
1102252012 12:111393950-111393972 AAGCAGAAGTAGAAAGCGGAGGG - Intergenic
1102289266 12:111685716-111685738 GCGCTGAAGCCGAAGCCGGCGGG + Exonic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102822962 12:115923841-115923863 GAGGAGAAGGAGAAGGGGGTGGG - Intergenic
1103410858 12:120710547-120710569 GAGGAGAAGAAGAAGGCGGGCGG + Exonic
1103851846 12:123938517-123938539 GAGCAGGAGAAGGAGGTGGCTGG - Intronic
1103941240 12:124502417-124502439 AAACAGAACCAGGAGGCGGCAGG + Intronic
1104013777 12:124949396-124949418 GAGCAGAAGCAGGAGGCAGAGGG + Intronic
1104903195 12:132200054-132200076 GAGTAGAAGCACAGGGAGGCTGG + Intronic
1104965849 12:132508517-132508539 TAGCAGAGGCAGGAGCCGGCTGG + Intronic
1106139251 13:26997830-26997852 AAACAGAAGCAGATGGAGGCTGG - Intergenic
1107907393 13:45073936-45073958 GAGCAGGAGGAAAAGGGGGCGGG + Intergenic
1108320363 13:49283657-49283679 CAAGAGAAGCAGAAGGAGGCAGG + Intronic
1108716294 13:53081391-53081413 GAGCTGAAGCAGAAGCCTGGGGG - Intergenic
1108975523 13:56438929-56438951 GAGCAGAAACTTAAGGCAGCTGG + Intergenic
1109149152 13:58823140-58823162 GAGCAGAAGAACAAGGTGGAAGG + Intergenic
1109988065 13:70016573-70016595 GGGCTGAAACAGAAGGAGGCTGG - Intronic
1112515416 13:100049044-100049066 GAGCAGAAGCAAGGGGAGGCAGG + Intergenic
1113377674 13:109780918-109780940 GAGCTGATGCAGAATGCAGCTGG - Intronic
1113494054 13:110714014-110714036 GGGCCGAAGCAGGAGCCGGCGGG + Intronic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1114222003 14:20705010-20705032 GAGAGGTAGCAGAAGGGGGCAGG - Intergenic
1114631393 14:24161619-24161641 GAGCTGCAGCAGAAGTGGGCAGG - Intronic
1114673567 14:24427550-24427572 GAACAGATGCAGCAGGTGGCTGG + Exonic
1115936723 14:38560751-38560773 GAGCAGAAGCAAAAGAGGGAGGG + Intergenic
1116223154 14:42113571-42113593 GCGCAGGAGCCGACGGCGGCCGG + Intergenic
1117187091 14:53251017-53251039 GAGCAGGAGGAGAAGGAGGGAGG - Intergenic
1117658684 14:57982538-57982560 GAGCAGAAGCAAAGGGCAGCTGG + Intergenic
1117978701 14:61321695-61321717 GAGGAGAAGCAAGAGGAGGCGGG + Exonic
1118849549 14:69573428-69573450 GTGCAGCCGCAGAAGGCGGGCGG - Exonic
1118877632 14:69798156-69798178 GAGCAGAAGCAGAGAGAGGTGGG + Intergenic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119800544 14:77441096-77441118 GGGAAGAAGCAGAAGGGAGCAGG + Intronic
1120905676 14:89619133-89619155 GAGCTGCAGCAGATCGCGGCCGG + Intronic
1122307339 14:100774062-100774084 GAGAAGATGCTGAAGCCGGCAGG - Intergenic
1122449842 14:101796833-101796855 GAGCAGAGGCAGCAGGGCGCTGG - Intronic
1122636726 14:103133446-103133468 GAGCAGCAGCAGCAGCTGGCTGG + Exonic
1122755247 14:103973543-103973565 GAGAAGAGGCAGAGGGCTGCCGG + Intronic
1124078660 15:26470670-26470692 GAGCAGAAGCAATAGGCTGCAGG + Intergenic
1124373319 15:29115564-29115586 GGGAAGAGGCAGGAGGCGGCCGG + Intronic
1125685832 15:41562721-41562743 GAGCAGCCTCAGAAGGGGGCTGG + Intronic
1126411806 15:48379948-48379970 GATCAGAAGCATAAGGAGGAGGG + Intergenic
1127142698 15:55993623-55993645 GAGGAGAAGCGGGAGGAGGCGGG + Intronic
1129327672 15:74809713-74809735 GAGGAGGAGCAGATGGAGGCAGG + Intergenic
1129725171 15:77897960-77897982 GAGCTGAAGAAGCAGGGGGCAGG + Intergenic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1132507412 16:318373-318395 GAGAAGCGGGAGAAGGCGGCTGG + Intronic
1132560758 16:592531-592553 GTGCAGGACCAGGAGGCGGCAGG - Intronic
1134369489 16:13609760-13609782 GAGCAGGAGCAGATGGGGGAAGG + Intergenic
1137412878 16:48244417-48244439 GAGCAGCAGCGGGAGGCGACTGG - Exonic
1137593580 16:49708826-49708848 GTGCTGAAGCAGGAGGAGGCAGG - Intronic
1140766654 16:78165611-78165633 GAGCAGAGCCTGAAGGGGGCTGG + Intronic
1140834522 16:78780925-78780947 GAGCAGCAGCAGAAGTGTGCAGG + Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142642479 17:1292444-1292466 GAGCAGCACCAGAAGGAGGGTGG - Intronic
1142805485 17:2369116-2369138 GAGCAGAATCAGCAGGCGGTTGG + Intronic
1142940739 17:3378295-3378317 GGGCAGAGGCAGCAGGGGGCTGG + Intergenic
1143238971 17:5427772-5427794 GGGCAGAGGCAGAGGGAGGCTGG + Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143647401 17:8239849-8239871 GAGCAGATGCAGAAGGGGAATGG - Intronic
1143689125 17:8545916-8545938 CAGCACAAGGACAAGGCGGCAGG + Intronic
1144346555 17:14354785-14354807 GAGAGGAAGCAGAAGTGGGCAGG - Intergenic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1146533112 17:33627483-33627505 GAGCAGCAGCAGGAGGGAGCTGG - Intronic
1146717851 17:35101234-35101256 GAGCAGGAGCATCAGGCGGCCGG - Exonic
1146833350 17:36089261-36089283 TAGCTGAAGCAGCAGGCGGTCGG + Exonic
1146847873 17:36195876-36195898 TAGCTGAAGCAGCAGGCGGTCGG + Exonic
1147327453 17:39676304-39676326 AAGGAGAAGAGGAAGGCGGCAGG + Intronic
1148070441 17:44905701-44905723 CAGCAGCAGCAGCAGGTGGCAGG + Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149549235 17:57527646-57527668 GAGCAGAAGGGGAAGGCCCCAGG + Intronic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1150702649 17:67461150-67461172 GAGAAGAAGCAGGAGGAGGCAGG - Intronic
1150896241 17:69213774-69213796 GAGCAGAATCGGAAGGGGCCAGG - Intronic
1151576851 17:74956810-74956832 GAGAGGAAGCAGAAGGAGCCAGG - Intronic
1152268359 17:79309396-79309418 GAGAAGCAGCAGGAGGGGGCGGG - Intronic
1152494611 17:80662217-80662239 GATAGGAGGCAGAAGGCGGCTGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152511813 17:80795113-80795135 GAGCAGATGCAGCACACGGCTGG + Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1156160292 18:34350938-34350960 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1156736078 18:40261811-40261833 GAGCAGGAGCAGGAGACGGAGGG - Intergenic
1157006482 18:43589885-43589907 GGGCCGAAGCAGCAGGAGGCTGG + Intergenic
1157446373 18:47749435-47749457 GGGGAGAAGCAGAGGGCGGGGGG - Intergenic
1157804074 18:50645040-50645062 GAGCAGAAGGAGAGGCCTGCAGG + Intronic
1158425978 18:57339997-57340019 GAGCAGGAGCAGCAGGCAGTGGG - Intergenic
1158635365 18:59151577-59151599 CAGCAGGTGCAGAAGGTGGCAGG - Intronic
1158685935 18:59614540-59614562 GATCAGGAGCAGCAGACGGCTGG + Intronic
1158859555 18:61579015-61579037 CAGCATAAGCAGGAGGCTGCTGG + Intergenic
1159783786 18:72690745-72690767 AAGTAGAAGCAGAAGGAAGCAGG + Intergenic
1160239260 18:77111496-77111518 GGGCAGCAGCAGAAGGCTGTGGG + Intronic
1160720333 19:594387-594409 CAGCAGCAGCAGGAGACGGCAGG - Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1162481398 19:10928919-10928941 GAGTAGCGGCGGAAGGCGGCAGG + Intronic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163851646 19:19667788-19667810 AAAAAGAAGCAGGAGGCGGCTGG + Intergenic
1164570072 19:29367858-29367880 AAGCAGAAGGAGGAGGCGGGAGG - Intergenic
1164594858 19:29526160-29526182 GAGCAGAACCAGAAGGAGACAGG + Intergenic
1165631487 19:37305413-37305435 GAGCAGGAGGCGAAGGTGGCTGG - Intergenic
1165944403 19:39433058-39433080 GAGTGGAAGCAGAAGGCAGGGGG - Intergenic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166502450 19:43352344-43352366 GAGGAGAAGCAGAAGAGGGAAGG - Intergenic
1166560288 19:43728317-43728339 GAGCAGGAGCAAGAGGGGGCAGG - Exonic
1166861922 19:45816050-45816072 GAACAGAAGCTGAAGCCGGGAGG - Exonic
1166868032 19:45852917-45852939 GAGCAGAAGCAGAAGGAGAGTGG - Intronic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167502667 19:49856571-49856593 GCCCAGAAGCAGGAGGTGGCTGG + Intronic
1202695162 1_KI270712v1_random:118170-118192 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
925031742 2:655079-655101 GAGCAGAGGCGGAAGCCTGCTGG + Intergenic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
926111312 2:10185932-10185954 TAGCTGAAGCAGTAGGCTGCTGG + Intronic
926231583 2:11008234-11008256 GAGCTGCAGCAGAAGGAGGAAGG - Intergenic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
927146736 2:20171116-20171138 GAGCAGAAGGAAAAGAGGGCAGG - Intergenic
929080954 2:38121707-38121729 AAGCAGCAGCAGATGGCTGCTGG + Intergenic
929604359 2:43225370-43225392 CAGCAGCAGCAGAAGGGGGGCGG - Exonic
929783978 2:44975958-44975980 GAGCAGAAGCCGGGGGCGGGAGG + Intergenic
929953767 2:46439263-46439285 GAGCAGAGGAAGAAGTCTGCGGG + Intronic
930349094 2:50226509-50226531 GAGGAGAAGCACAAGGAGGAGGG + Intronic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
933249598 2:80014256-80014278 GAGCAGAAGCTGCAGGAGGAAGG + Intronic
933791651 2:85888521-85888543 GAGCTGCAGCGGAAAGCGGCGGG + Intronic
934276332 2:91575219-91575241 GTGCAGAGGCAGCAGGTGGCAGG + Intergenic
935133904 2:100281805-100281827 GAAAAGAGGCAGAAGGGGGCAGG + Exonic
936479990 2:112877252-112877274 GAGCAGAAGCACTAGTGGGCTGG + Intergenic
937020206 2:118643546-118643568 GAGCAGAAGCAGAAGCTGTCAGG + Intergenic
937076789 2:119113024-119113046 GAGCAGAGGAGGTAGGCGGCTGG + Intergenic
937167733 2:119836834-119836856 GGGCCGAGGCAGAAGGAGGCTGG - Intronic
937434299 2:121867515-121867537 GAGCAGAAGCAGGTGGCACCTGG - Intergenic
937445266 2:121952251-121952273 GAGCAGGAGCAGAAGGTGACCGG + Intergenic
937543677 2:122989294-122989316 GAGCTGAGGCAGCAGGGGGCTGG - Intergenic
937939748 2:127275858-127275880 AAGCAGAAGCTGGAGCCGGCAGG + Intronic
938095274 2:128457321-128457343 GAGCAGAAGCAGGCAGCAGCAGG - Intergenic
938224886 2:129607075-129607097 GAAGAGAAACAGAAGGCTGCAGG - Intergenic
938291047 2:130150679-130150701 GAGCAGAAGCAAAATGCAGTTGG - Intergenic
938380038 2:130831506-130831528 GAGCAGGGGCACAAGGAGGCAGG + Intergenic
939802955 2:146735675-146735697 GAGCTGAAGTAGAAGGCAGATGG - Intergenic
940180720 2:150929614-150929636 AAGCGGCAGCAGAAGGCGGGTGG + Intergenic
941619403 2:167759173-167759195 GACCAGCAGCAGAAGACGGTAGG + Intergenic
943333863 2:186590376-186590398 GAGAAGAAGCGGGAGGCCGCGGG - Exonic
943363410 2:186947178-186947200 AGGCAGATGCAGAAGGCTGCTGG + Intergenic
944446742 2:199799417-199799439 CTACAGAAGCAGAAGGCAGCCGG - Intronic
944908740 2:204288359-204288381 AAGCAGAAGAAGAAGGCTGAGGG + Intergenic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
947448537 2:230183484-230183506 GAGAAGAAGGAGAGGGCGGGTGG + Intronic
947499000 2:230658814-230658836 GAGCAGGAGCAGGAGCAGGCAGG + Intergenic
948080422 2:235200978-235201000 AGGCAGAGGCAGAGGGCGGCAGG - Intergenic
948498906 2:238376438-238376460 AAGAAGAGGCATAAGGCGGCAGG - Intronic
1168766052 20:381989-382011 GAGCCCAAGCGAAAGGCGGCGGG - Intronic
1169792058 20:9421631-9421653 GAGGAGAACCAAAAGGAGGCAGG - Intronic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1172223312 20:33288259-33288281 GAGCAGAGGAAGAAGGAGCCAGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1176143814 20:63556752-63556774 GAGCAGGAGCAGAAGGCCTGGGG - Intergenic
1179571098 21:42279362-42279384 GAGCAGACGCAGGAGGCGGAGGG + Intronic
1179613039 21:42564759-42564781 GAGCAGCAGCATCAGGCCGCAGG - Exonic
1181085314 22:20437008-20437030 GACCAGAAGCGGGAGGCGGAAGG - Intronic
1181110638 22:20600772-20600794 GAGCAGAAGCAAAATGCAGTTGG - Intergenic
1181450510 22:23017131-23017153 GAGCAGGAGCCCACGGCGGCGGG + Intergenic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182051831 22:27318157-27318179 GAGGAGAAGCAGGAGGCGGGTGG + Intergenic
1183165117 22:36141647-36141669 CAGCAGAAGCTGAAGCCAGCAGG - Exonic
1183325096 22:37187123-37187145 TAGCAGCAGGAGAAGGGGGCTGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184806279 22:46796724-46796746 GGGCAGCAGCAGAGGGCGGGAGG + Intronic
1184810819 22:46830528-46830550 GAGCAGAAGCAAAGGGCTGGTGG + Intronic
949980265 3:9498421-9498443 CAGCAGCAGCAGAAGGGGTCAGG + Exonic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
952272309 3:31845210-31845232 GAGCAGGAGAAGATGGAGGCAGG - Intronic
952799547 3:37275738-37275760 GTGCAGAAGAAGAACGCGGCTGG + Intronic
952920114 3:38278182-38278204 GAGCATGAGCAGGAGGAGGCGGG - Exonic
953563446 3:44012387-44012409 GAGCAGCAGCAGTAGGCTGGGGG - Intergenic
953703154 3:45212102-45212124 TGGCAGAAATAGAAGGCGGCAGG + Intergenic
955281293 3:57597162-57597184 GGGCAGAAGCAGAAGGGGTTTGG + Exonic
955601604 3:60651724-60651746 GAGCAGATGCAGAAAGTTGCAGG - Intronic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
958603050 3:96323635-96323657 GAGGAGGAGGAGAAGGCGGGGGG + Intergenic
960664130 3:120094081-120094103 GAGCAGCTGCAGGCGGCGGCTGG + Intronic
962255771 3:133869185-133869207 GAGAAGAAACAGAAGGCAACAGG + Intronic
962963628 3:140334013-140334035 GAGCAAGAGAAGAAGGCGGGGGG + Intronic
963923688 3:150929328-150929350 GAGCAGAAGCAGGTGGCAGGAGG + Intronic
964561097 3:157997421-157997443 AAGTAGAAGCAGAAGGCAGAAGG - Intergenic
964698355 3:159535466-159535488 GAGCAGAACCAGGAGGAAGCAGG - Intronic
967108705 3:186273954-186273976 GAGCAGGAGGAGAAGGCAGAGGG - Intronic
967807741 3:193730531-193730553 GTGCAGAAGCAGCTGGCTGCTGG - Intergenic
968672158 4:1857431-1857453 GCGGAGAAGCAGGAGGAGGCAGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970418671 4:15884027-15884049 GAGGAGTAGCAGCAGGCGGTTGG + Intergenic
972217817 4:36916709-36916731 GAGAAGGAGCAGTAGGAGGCAGG - Intergenic
976504441 4:85830848-85830870 GAGTAGGAGCAGATGGCAGCAGG + Intronic
976635111 4:87279564-87279586 GAGGAGAGGCAGAATGAGGCGGG + Intergenic
976786100 4:88823333-88823355 GAGCAGAAGGAGTAGGGTGCGGG - Intronic
977642279 4:99370467-99370489 GAGCTGAAGTAGAGGGCGTCTGG - Intergenic
978151671 4:105443332-105443354 GTGAAGAAGCAGAAGGCAGAAGG + Intronic
979448273 4:120839887-120839909 GAGCTGAGGCAGCAGGCAGCTGG + Intronic
980492951 4:133552949-133552971 GAGCAGAAGCAGCAGGATGTTGG - Intergenic
980658766 4:135827992-135828014 GAGCAGAAGAACAAAGCAGCAGG + Intergenic
983698259 4:170559503-170559525 GAGGAGAAGCAGGAGCAGGCAGG - Intergenic
985345049 4:188995512-188995534 GAGCAGAAGCAGAAGGACAAAGG + Intergenic
985429774 4:189868018-189868040 GAGAAGAAGCAGATGCAGGCAGG - Intergenic
985563303 5:602766-602788 CAGCAGAAGCTGGAGGCGACGGG - Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
985878496 5:2619259-2619281 GAACAAAAGCAGAAGTCTGCAGG + Intergenic
985901490 5:2798771-2798793 GTGCTGAAGGAGAAGGCTGCTGG - Intergenic
986183932 5:5418915-5418937 GATCGGAGGAAGAAGGCGGCAGG - Intergenic
987740800 5:21906782-21906804 GAGTAAAGGCAGAAGGCAGCTGG - Intronic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988645791 5:33093514-33093536 GAGCTGAAGCAGGAGGAAGCTGG - Intergenic
990537991 5:56742728-56742750 GAGAAGAAGAAGAAGGGGGGAGG - Intergenic
991425770 5:66490080-66490102 TAGAAGAAGTAGAAGACGGCAGG - Intergenic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
993312546 5:86353858-86353880 TGGCAAGAGCAGAAGGCGGCAGG - Intergenic
994302719 5:98165073-98165095 AAGCAGAAGCAGAAGGGGAAGGG - Intergenic
994926274 5:106120949-106120971 GAGCAGAGCCAGAAGGCGGGAGG - Intergenic
996432999 5:123401946-123401968 CTGCAGCAGCAGAAGACGGCCGG - Intronic
997347571 5:133203053-133203075 GAGCATATGCAGAAGGCAGGAGG - Intronic
998887259 5:146707215-146707237 CTGCAGCAGCAGAAGACGGCTGG - Intronic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
1000010112 5:157223132-157223154 GAGCAGAGGCAGAAGGAAGAGGG + Intronic
1001532988 5:172477800-172477822 GAGAGGGAGCAGAAGGCAGCAGG - Intergenic
1001543710 5:172557110-172557132 GAGCAGAAGCAGGAGGAGGGAGG - Intergenic
1002352440 5:178592412-178592434 GAGCAGAGGCAGAAGGAAGAAGG + Intergenic
1002787727 6:417238-417260 GAGCAGAGGCAGAGGGCAGAGGG - Intergenic
1004122106 6:12833843-12833865 GAGTAGAAGGAGAGGGAGGCTGG - Intronic
1005948313 6:30611664-30611686 GAGCAGCAGCAGAAGCAGGGAGG + Intronic
1006145037 6:31953829-31953851 GAGCTGAAGCAGAAGAGGGGAGG + Exonic
1006881096 6:37340868-37340890 CAGCAGCAGCAGAAGGCAGTGGG - Intergenic
1007237093 6:40398403-40398425 GAGCAGCAGCAGAAGGTCGGCGG - Intronic
1007275846 6:40673077-40673099 GGGAAGAAGAAGAAGGCGGGGGG - Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007576678 6:42929596-42929618 GGGAAGAAGCAGAAGACAGCGGG - Exonic
1009684996 6:66945277-66945299 GGGCACAACCAGAAGGCTGCAGG - Intergenic
1009940065 6:70280877-70280899 GAGCAGGGGCAGAAGGGTGCGGG + Intronic
1010033347 6:71291639-71291661 GAGCAGGAGCAGATGCTGGCAGG + Intronic
1011618777 6:89222541-89222563 GAGCAGATGCAGAACGGGGGTGG - Intronic
1012054953 6:94394507-94394529 GAGAAGAAGCAGAAGAAGTCAGG + Intergenic
1013180415 6:107712561-107712583 GAGCAGAGGCAGCAGGGGCCTGG + Intronic
1013226839 6:108125290-108125312 CAGCAGAGGCAGAAGGCAGCAGG - Intronic
1013839040 6:114368156-114368178 GAGCTGAAGCTGAAGCTGGCTGG + Intergenic
1015452642 6:133388929-133388951 GAGCAGAAGCAGAAGGACGTGGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017121943 6:151032317-151032339 GGGCAGAAGGTGAAGGCGGGGGG + Intronic
1017381928 6:153841386-153841408 TAGAAGAAACAGAAGACGGCCGG + Intergenic
1017679937 6:156853470-156853492 GAGCAGTAGCTGGAGGCTGCAGG + Intronic
1017995971 6:159531960-159531982 GAGCAGCAGCAGAAGGAGAAGGG - Intergenic
1018501894 6:164420228-164420250 GAGGAGAAGGAGAAGGCTACAGG - Intergenic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020748671 7:12111798-12111820 GATCAGAAGCAGGAGGCAGGAGG - Intergenic
1022230799 7:28410260-28410282 CAGCGGAGGCAGGAGGCGGCCGG - Intronic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1022522342 7:31016402-31016424 GAGCAGAGGCAGGTGGCGGGGGG - Intergenic
1023026590 7:36056396-36056418 GAGAAGAAGCAGGAGGAAGCAGG + Intergenic
1023616900 7:42029191-42029213 GAGCAGCAGCAGAAGGTCGAGGG - Intronic
1023648542 7:42344542-42344564 GGCCAGAAGCAGAAGGCCTCAGG + Intergenic
1025284352 7:57650147-57650169 GAGCAGAAGAAGCAGGAGGGAGG + Intergenic
1026117761 7:67510633-67510655 GAGCAGAAGGAAGAGGCGGGGGG - Intergenic
1026584293 7:71643692-71643714 TTGCAGCAGCAGAAGGCAGCAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1029110943 7:98212769-98212791 CAGCAGCAGCAGCAGGTGGCTGG + Exonic
1029675958 7:102069094-102069116 GAGGAGGAGGAGAGGGCGGCTGG - Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1031879964 7:127186556-127186578 GTGCAAGAGCAGAAGGCAGCTGG - Intronic
1032525037 7:132573621-132573643 GAGTAGCAGCAGCAGGCGACAGG + Intronic
1033331467 7:140420447-140420469 AAGAAGGAGCAGAAGGAGGCAGG + Intronic
1033332524 7:140428334-140428356 GAGGAGCAGCAGAATGCGGCTGG - Intergenic
1034257492 7:149732671-149732693 GAGTAAAAGCAGAAGGGGGTGGG + Intronic
1034905978 7:154946674-154946696 GAGCACAAGCAGAACTCGGTGGG - Exonic
1035171081 7:157017877-157017899 TAGCAGCGACAGAAGGCGGCGGG - Intergenic
1035670633 8:1414506-1414528 GAGCAGAAGCGGAAGGTGGCGGG + Intergenic
1035737337 8:1898257-1898279 GAGCAGGTGCAGAAAGTGGCTGG + Intronic
1035769165 8:2133151-2133173 CAGCAGTAGCAAAAGGCTGCTGG + Intronic
1035844883 8:2852563-2852585 GAGCAGAAGCAAGAGACGGAGGG - Intergenic
1036565349 8:9933745-9933767 GAGCAGAGGCGGGAGGGGGCGGG - Intergenic
1037645756 8:20791335-20791357 GAGAAGAAGCAAAAAGCAGCAGG + Intergenic
1037747832 8:21661055-21661077 GAGCAGAAGGAGAGGCCGGTAGG - Intergenic
1037812702 8:22096411-22096433 GAGCAGCAGCAGGCGGCCGCGGG + Exonic
1037874998 8:22539879-22539901 GAGCAGAGGCAGAAGTAGACTGG + Intronic
1037987546 8:23299291-23299313 GAAGAGAAGCAGAAGGGTGCAGG + Intronic
1038326960 8:26578891-26578913 GAGCAGAGGAGGAAGGCGGGGGG + Intronic
1038686008 8:29719113-29719135 GAGGGGAAGCGGAAGGCAGCAGG - Intergenic
1038927116 8:32153175-32153197 GAAGAGAAGCAGAAGGCCGGTGG + Intronic
1039389600 8:37167167-37167189 GAGCAGAACCAGAAGAGTGCTGG + Intergenic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1041042594 8:53862444-53862466 GATCAGAAGTAGAAGCCAGCAGG - Intronic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041479464 8:58302678-58302700 GAAGAGAAGCAGAAGCCGGGAGG + Intergenic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1044725104 8:95188300-95188322 GTGGAGAAGCAGAAGGCAGCAGG + Intergenic
1045118700 8:99012783-99012805 GGGCAGAAGCAATAGGCCGCTGG - Intergenic
1047402330 8:124557504-124557526 GGGGAGAAGCAGAAAGCAGCCGG - Intronic
1047601305 8:126428547-126428569 GAGCAGAAGAAGAAGTCAGAGGG - Intergenic
1048695122 8:137019178-137019200 GAGCAGAAGCAGAAAGCAACAGG + Intergenic
1048972124 8:139651034-139651056 GGGAAGAAGCAGAAGGGGGTGGG - Intronic
1049361296 8:142213627-142213649 GAGCAGAGGAAGGAGGCAGCTGG + Intronic
1049536559 8:143185360-143185382 CAGCAGACGCAGGAGGCGGGAGG - Intergenic
1051436617 9:17040419-17040441 GAACAGGAGCAGAAGGTGGGTGG - Intergenic
1052996166 9:34552575-34552597 GAGCAGAGGCTGGAGGCAGCAGG + Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1054437419 9:65225348-65225370 GAGCAGCAGCAGAAGCTGCCAGG + Intergenic
1056763598 9:89431247-89431269 GAGCAGGAGCAGGAGCCGCCAGG - Intronic
1056796098 9:89659902-89659924 GAGCAGAAGCAGAAACCTGGAGG - Intergenic
1057274703 9:93670178-93670200 GAGCAGAGGGAGAGGACGGCAGG + Intronic
1057739767 9:97701172-97701194 GAGCCGAAGGAGAAGGAGGAGGG - Intergenic
1058472947 9:105299746-105299768 CAGCAGACACAGAAGGCAGCAGG - Intronic
1059465406 9:114466273-114466295 GCTCTGAAGCAGAAGGCAGCGGG - Exonic
1060283520 9:122228973-122228995 GAGGAGAAGAAGGAGGGGGCGGG - Intronic
1061144829 9:128791512-128791534 GAGCAGCAGCCGCAGGAGGCAGG - Intronic
1061928877 9:133822041-133822063 GGGCAGAAGGTGAAGGTGGCAGG - Intronic
1061972059 9:134050291-134050313 GGGCAGGAGCAGCAGGCGGGGGG - Intronic
1061977680 9:134078860-134078882 GAGCAGAAGCAGAAGCGGTTTGG - Intergenic
1062371661 9:136242398-136242420 GACCAGTGGGAGAAGGCGGCTGG + Intronic
1185661991 X:1735428-1735450 GAGCAGAAAGAGAAGGAGGGAGG - Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1187447630 X:19373014-19373036 GAGCAGAAGGAGGGGGAGGCGGG + Intronic
1188841702 X:35025030-35025052 GAGCAGAAGGAGAAGCAGCCAGG + Intergenic
1188988440 X:36788996-36789018 GAGCAGAAGGAGAAGCAGCCAGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1189785484 X:44555463-44555485 GAGGAGAAGCAGCAGGCGATTGG - Intergenic
1190062835 X:47222032-47222054 AAGAGGAAGCAGAAGACGGCTGG + Intronic
1190369438 X:49727093-49727115 GGGCAGAGGCAGCAGGGGGCTGG - Intergenic
1190712608 X:53081399-53081421 GGGCAGAAGCGGAGGGCGGGAGG + Intergenic
1190879728 X:54483723-54483745 GAGGAGAAGCAGACCGGGGCTGG - Intronic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1192252829 X:69427582-69427604 GATGAGAAGAGGAAGGCGGCAGG - Intergenic
1192502680 X:71664078-71664100 GTGCAGAAGGTGGAGGCGGCGGG + Intergenic
1193428433 X:81369902-81369924 GAGCAGAACCTGAAGGCAGTTGG + Intergenic
1195342809 X:103921305-103921327 GAGCAGAAGCAAAAGTCTGAAGG - Intronic
1195363986 X:104110252-104110274 GAGCAGAAGCAAAAGTCTGAAGG + Intronic
1195576843 X:106460925-106460947 GAACATAAGCAGCAGGAGGCGGG - Intergenic
1198965262 X:142221637-142221659 GAGCAGAAAGAGAAGGCAGAGGG + Intergenic
1199699077 X:150363362-150363384 GAGCTGAAGCGGCCGGCGGCGGG + Intronic
1200781816 Y:7223516-7223538 GAGCAGAAGCTGGAGAGGGCTGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic
1201917562 Y:19198686-19198708 GAGCAGAAGCTGTAGAGGGCTGG + Intergenic