ID: 1163262212

View in Genome Browser
Species Human (GRCh38)
Location 19:16198107-16198129
Sequence CGGCAGGGGCCTCCGCCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 210}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163262199_1163262212 2 Left 1163262199 19:16198082-16198104 CCCACCCTCCCTGTTGCCAGGCA 0: 1
1: 1
2: 6
3: 30
4: 398
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262200_1163262212 1 Left 1163262200 19:16198083-16198105 CCACCCTCCCTGTTGCCAGGCAA 0: 1
1: 0
2: 5
3: 26
4: 338
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262205_1163262212 -7 Left 1163262205 19:16198091-16198113 CCTGTTGCCAGGCAACCGGCAGG 0: 1
1: 0
2: 0
3: 14
4: 130
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262195_1163262212 28 Left 1163262195 19:16198056-16198078 CCTGAAGGGCAAGGTACTGAGGG 0: 1
1: 0
2: 0
3: 11
4: 169
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262204_1163262212 -6 Left 1163262204 19:16198090-16198112 CCCTGTTGCCAGGCAACCGGCAG 0: 1
1: 0
2: 1
3: 6
4: 120
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262201_1163262212 -2 Left 1163262201 19:16198086-16198108 CCCTCCCTGTTGCCAGGCAACCG 0: 1
1: 0
2: 1
3: 17
4: 162
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262198_1163262212 3 Left 1163262198 19:16198081-16198103 CCCCACCCTCCCTGTTGCCAGGC 0: 1
1: 1
2: 3
3: 61
4: 496
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210
1163262202_1163262212 -3 Left 1163262202 19:16198087-16198109 CCTCCCTGTTGCCAGGCAACCGG 0: 1
1: 0
2: 1
3: 12
4: 130
Right 1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG 0: 1
1: 0
2: 0
3: 21
4: 210

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163262212 Original CRISPR CGGCAGGGGCCTCCGCCCGC GGG Intronic
900204935 1:1427698-1427720 CCGCTGCTGCCTCCGCCCGCTGG + Exonic
900205865 1:1431653-1431675 GGGCAGGGGCCTCAGCCACCGGG - Intergenic
900648264 1:3718642-3718664 CTGCCGGGGCCTCTGCCCGCAGG + Intronic
902508854 1:16954778-16954800 CCGCAGCAGCCTCCTCCCGCTGG - Exonic
902559456 1:17267862-17267884 CTGCAGGGCCCTGCGTCCGCAGG - Exonic
902669865 1:17965710-17965732 CGGCAGAGGCCTCCACACCCAGG - Intergenic
902824894 1:18966146-18966168 CTGCAGAGGCCTCCGCCGGTGGG + Intergenic
902979416 1:20112524-20112546 CTGCAGGTGCCTCAGCCCCCTGG + Exonic
904128778 1:28260374-28260396 AGGAAGGGTCCTCTGCCCGCCGG - Intronic
905066897 1:35192262-35192284 CACCAGGGGCCCCCGCCCGGCGG - Exonic
905656876 1:39691246-39691268 GGGCCAGGGCCTCCGCCCGGTGG + Intronic
905875868 1:41431861-41431883 CGGCAGGGGGCACCTCCCGCTGG - Intergenic
910221438 1:84893042-84893064 CCGCAGGGGCCCCCGCTCCCGGG - Intronic
913518367 1:119623688-119623710 CGGCAGCGGCCTCAGCCAGGCGG + Exonic
918388851 1:184037414-184037436 CGGCAGCCGCCGCCGCCCTCAGG - Exonic
918793166 1:188857758-188857780 CGGCGGGTGCCACCGCCCCCAGG + Intergenic
920196239 1:204229029-204229051 CGCCAGGCTCCTCTGCCCGCAGG + Exonic
923036250 1:230287109-230287131 CTGGAGTCGCCTCCGCCCGCCGG + Intergenic
923119663 1:230978607-230978629 CTGCAGCCGCCGCCGCCCGCCGG + Exonic
1064662127 10:17617133-17617155 CCCCAGGCGCCTCCGCTCGCCGG + Exonic
1065316931 10:24472808-24472830 CGGCAGGGTCATCCTCCCTCTGG + Intronic
1067553519 10:47252271-47252293 GGGCATGGGCCTCAGCCAGCAGG - Intergenic
1070162572 10:73874686-73874708 GGGGAGGGGCCTCCCGCCGCCGG + Intergenic
1075430236 10:122374535-122374557 CGGCGGCGGCCTCGGCGCGCCGG - Intergenic
1076075901 10:127533659-127533681 GGGAAGGGGCCCCCGCCCCCAGG + Intergenic
1076650346 10:131982590-131982612 TGTCCGGGGCGTCCGCCCGCAGG + Intergenic
1077077195 11:707095-707117 GGGGAGGGGCCGCCGCCAGCTGG - Intronic
1077178842 11:1203342-1203364 CGGGAGGGGCCGCGGCCCTCCGG - Intergenic
1077303187 11:1856457-1856479 GGGCAGCGGCCTCCCACCGCGGG - Intronic
1077926198 11:6683690-6683712 CGGTAGGGCCGTCAGCCCGCAGG - Intergenic
1078356276 11:10634055-10634077 CGGCAGGGTCCTCCTGCCGCAGG - Exonic
1083885713 11:65572599-65572621 CCGCCCGGGCCGCCGCCCGCAGG - Exonic
1083901698 11:65646505-65646527 GCGAAGGGGCCTCCGCCAGCAGG - Exonic
1084792081 11:71481309-71481331 GGGCAGGGGCCACCGCCTCCGGG + Intronic
1089294347 11:117458944-117458966 CAGCAGGGGCCACAGCCCGATGG - Intronic
1092209790 12:6638805-6638827 GGGCAGAGGCCTCCACCAGCAGG - Intronic
1092462231 12:8697444-8697466 CGGCAGGACCCTGCGCCCGAGGG + Intronic
1096101011 12:48970492-48970514 CGGCCGCGGCCTCCGCCCTCGGG - Exonic
1096618563 12:52848311-52848333 GGGCAGGGCCTTCCCCCCGCTGG + Intronic
1096839362 12:54371012-54371034 CGGCTGGGGCCTCCCACCCCGGG - Exonic
1101813583 12:108129139-108129161 GGGCAGGGGCCTCAGCCTTCCGG - Intergenic
1102442129 12:112971473-112971495 CTGCTGGGGACTCCGCCCCCTGG - Exonic
1103085776 12:118061077-118061099 CGGCGGGCGCCTCAGCCCCCCGG + Intronic
1103413018 12:120725980-120726002 CCGCCAGGACCTCCGCCCGCTGG - Intronic
1103568293 12:121828079-121828101 GGGCAGGGGCCACCCCCCGCTGG - Intronic
1103913732 12:124365455-124365477 CGGCAGGGGCCTCAGCACCCTGG - Intronic
1104661339 12:130613237-130613259 AGGCAGGGGACGCCGCCCCCAGG + Intronic
1104831728 12:131757188-131757210 CAGCAGTGGGCTCCCCCCGCGGG + Intronic
1107440475 13:40422972-40422994 TGGCAGGGCCCTCCTCCCTCTGG + Intergenic
1112415507 13:99200733-99200755 AGTCAGGGGCGTGCGCCCGCTGG - Intergenic
1113464818 13:110505789-110505811 CAGCAGTGGCCTCCCTCCGCTGG - Intronic
1113914546 13:113862938-113862960 CGCCCGGGGCCGCCTCCCGCAGG - Intronic
1115399251 14:32939161-32939183 CGGCCCCGGCCACCGCCCGCCGG + Intronic
1122634388 14:103123344-103123366 GGGCCTTGGCCTCCGCCCGCGGG + Intergenic
1122860363 14:104579782-104579804 CTGGAGGCGCCACCGCCCGCTGG - Exonic
1125606408 15:40942063-40942085 CGGGAGGGGCCGCCGACCCCGGG + Intergenic
1127088120 15:55443321-55443343 CGCCAGGCGCCTCCGCACGCTGG - Intronic
1128651170 15:69414658-69414680 CGGCAGGGGTCTCCGCGCCCAGG - Intronic
1129922175 15:79328808-79328830 CTCCAGGGGCCTCTGCCCCCAGG - Intronic
1130531256 15:84748876-84748898 CGGAAGGGGCCGGCGCCCGACGG - Intronic
1132419535 15:101653035-101653057 CGGCAAGGGTCTCCGCAAGCTGG - Intergenic
1132585873 16:705575-705597 CGGCATGGGCGTCGGCGCGCGGG + Exonic
1132589817 16:721745-721767 GGGCAGGGGCGCCCGCCAGCAGG - Intronic
1132699853 16:1217715-1217737 CAGCAGGGGCCTCGGCCCAGGGG + Intronic
1132754226 16:1474864-1474886 CAGCAGCGGCGTCCCCCCGCCGG + Exonic
1132845580 16:1999519-1999541 GGGCAGGGGCCGCCGAGCGCTGG + Exonic
1133213117 16:4273818-4273840 CGGCAGCGGCCCCCGGGCGCAGG + Intergenic
1133744129 16:8674489-8674511 CGCCACGGGCCACCGCCCCCAGG - Intergenic
1134687616 16:16169712-16169734 CTGCAGGGTCGTCCGCCCACAGG + Exonic
1139388458 16:66589461-66589483 CTGCAGGGGCCTCCTTCCTCCGG - Intergenic
1142115430 16:88353817-88353839 CGCCTGGGGCCTCCGGCAGCTGG + Intergenic
1142149341 16:88505849-88505871 CGGCAGGTGCAGCCGCCGGCAGG + Intronic
1142178478 16:88655913-88655935 CGGCGGGCGCCACCACCCGCTGG - Intronic
1142221605 16:88857523-88857545 GGGCCGGGGCCGCCGTCCGCGGG - Intronic
1142664683 17:1455907-1455929 CAGCAGCGGCCCGCGCCCGCCGG - Exonic
1143034982 17:3989607-3989629 TGGCCGGGGCCTCGGCCTGCAGG + Intergenic
1143183415 17:4997634-4997656 CGGCAGGAGGCTCCGCCCCCTGG + Intergenic
1143599271 17:7933214-7933236 GGGCCGTGGCCTCCGCCTGCCGG - Exonic
1144755988 17:17681225-17681247 CCGCAGAGGCCCCCTCCCGCAGG + Intergenic
1145295970 17:21592960-21592982 CGCCAGGGTCCAACGCCCGCTGG + Intergenic
1145367818 17:22279102-22279124 CGCCAGGGCCCAACGCCCGCTGG - Intergenic
1146283236 17:31558855-31558877 CGGCAGGGGGCTCCCCGCGCCGG + Intergenic
1147402859 17:40191524-40191546 CGGCGCGGGCCTCCGGCCTCCGG - Intronic
1148559534 17:48597948-48597970 CGGCCGTAGCCACCGCCCGCCGG + Exonic
1149678502 17:58487745-58487767 CAGCAGCCGCCGCCGCCCGCGGG - Exonic
1152282947 17:79396128-79396150 AGGCAGGGCCCTCCGGCCCCAGG - Intronic
1152433298 17:80260996-80261018 CGGGAGGGGCATCCGGACGCAGG - Intronic
1152562793 17:81086912-81086934 CGGTCGTGGCCTCCGCCTGCAGG + Intronic
1152567075 17:81105092-81105114 CGGCAGGGGTCTCCCCCCAGTGG + Intronic
1152567098 17:81105149-81105171 CGGCAGGGGTCTCCCCCCAATGG + Intronic
1152588016 17:81197660-81197682 CGTGAGGGGCCTCCTCCCACTGG + Intronic
1152855671 17:82663643-82663665 CGTCTGGGTCCTCCACCCGCAGG + Intronic
1155221530 18:23689895-23689917 GGGCTGGGGCCTCCCCTCGCCGG - Exonic
1159911117 18:74147635-74147657 CGCCAGGGGACCCCACCCGCAGG + Intronic
1160524765 18:79528978-79529000 CAGCCGGAGCCTCCACCCGCAGG - Intronic
1160778862 19:869001-869023 CGGCAGGGGCATCTGTCCACAGG + Intronic
1160881216 19:1321564-1321586 CGGCATGGCCCTCTGCCCACTGG - Intergenic
1161221811 19:3121273-3121295 GGGCCGGGGCCTCTGCCCGCGGG + Exonic
1163262212 19:16198107-16198129 CGGCAGGGGCCTCCGCCCGCGGG + Intronic
1164302149 19:23972077-23972099 CGGGGGGGGCCTACTCCCGCTGG - Intergenic
1164648171 19:29873854-29873876 CGGCACCGGCCACCGCGCGCTGG - Intergenic
1165236910 19:34428754-34428776 CGGGGCGGGCCTCCGCTCGCTGG + Intronic
1165470796 19:36003407-36003429 CAGCAGGGGCCTCCTGACGCGGG + Exonic
1165928585 19:39342374-39342396 CGACGGGGGCCGCCGCGCGCCGG - Intronic
1166074060 19:40403709-40403731 CGCCAGGAGCCTCAGCCTGCAGG - Exonic
1166679520 19:44758305-44758327 CGGCCGCGGGCTCCTCCCGCTGG + Exonic
1167144933 19:47675961-47675983 CTTCAGGGCCCTCCTCCCGCTGG - Intronic
1168423014 19:56217545-56217567 CGGCCGCGGCCTCCGCCTGGAGG - Intergenic
924968549 2:101185-101207 TGCCAGGGGCCTCCGCCTGCTGG - Intergenic
926111960 2:10189237-10189259 GAGCAGGGGCCACTGCCCGCAGG - Intronic
926742707 2:16125821-16125843 ATGCAGCGGCCTCCGCCTGCAGG - Intergenic
929778113 2:44941095-44941117 CGGCTGGCGCCACGGCCCGCTGG + Intergenic
931356194 2:61538898-61538920 CTGCGGGGGCCTGAGCCCGCGGG + Intergenic
932419308 2:71592187-71592209 CTGCAGGGTGCTCGGCCCGCAGG - Intronic
933667085 2:84971930-84971952 CGGCAGGCGCGTCCGGTCGCCGG + Intronic
935918761 2:107986711-107986733 CGCCCGGGGCCGCCGCCCCCTGG - Exonic
941934801 2:170974076-170974098 CAGCAGGAGCCTCCGCCCCGCGG - Intergenic
942459168 2:176157828-176157850 CGCCAGGCGCGTCCGCCAGCCGG - Intronic
943725137 2:191245345-191245367 CGGCCGGCCCCTCCGCCAGCGGG + Intronic
947724264 2:232387638-232387660 CGGCTGGGGCCTCTGCACCCAGG - Intergenic
947741461 2:232486833-232486855 CGGCTGGGGCCTCTGCACCCAGG - Intronic
948151470 2:235747920-235747942 GGGGTGAGGCCTCCGCCCGCTGG + Intronic
948953880 2:241272592-241272614 AGGCTGCGGCCCCCGCCCGCGGG - Intronic
1170602154 20:17849299-17849321 GGGCAGGGGCCTCACCCAGCAGG - Intergenic
1172793024 20:37519242-37519264 GGGCAGCCGCCTGCGCCCGCTGG - Exonic
1174034963 20:47663244-47663266 CAGATGGGGCCTCCTCCCGCAGG - Intronic
1175107474 20:56625635-56625657 CGGGGGGGACCCCCGCCCGCCGG - Intergenic
1175501989 20:59456958-59456980 CTCCCTGGGCCTCCGCCCGCGGG + Intergenic
1175518701 20:59585748-59585770 CCGCAAGGGCCTCTGCACGCGGG - Intronic
1179529890 21:42010970-42010992 CGGCAGGAGCCGCCTCCCGCGGG - Intergenic
1179625540 21:42647067-42647089 CGGCAGGGGCATTTGCACGCTGG - Intergenic
1180559338 22:16602340-16602362 CGGGAGCTGCCGCCGCCCGCGGG - Intergenic
1180701953 22:17785960-17785982 CGGCAGGAGGCTCCGGCCCCCGG + Intergenic
1182696602 22:32202961-32202983 CGGCAGGGGCCCCAGCCCCGTGG - Exonic
1183953776 22:41367428-41367450 AGGCAGGGGCCGCCAGCCGCAGG - Intronic
1184037400 22:41925337-41925359 GGGCAGGGGCCACCTCCTGCCGG + Exonic
1184258017 22:43298027-43298049 CGGTGGGGGCCTCAGCCCCCTGG - Intronic
1184776945 22:46628006-46628028 CGGCAGGGGCCTGCCTTCGCCGG + Intronic
1185121589 22:48974761-48974783 GGGCAGGGGCCTCAGCCAGAAGG - Intergenic
1185154360 22:49184168-49184190 CGGCAGGGACCACGGCCCCCTGG - Intergenic
949548862 3:5096105-5096127 CTGCAGGGGCTTCTGCCGGCAGG - Intergenic
958980016 3:100709700-100709722 CGGCCGCGGCCTCCGCAAGCCGG + Exonic
961518957 3:127455973-127455995 CGGCATGGGCCTCCCACCCCAGG + Intergenic
962301866 3:134250580-134250602 CGGCGGGGCCCTCAGGCCGCGGG + Exonic
962756369 3:138468127-138468149 CCGCAGGTGCAGCCGCCCGCTGG - Exonic
963733070 3:148991428-148991450 CGGCAGGGGCGGTGGCCCGCGGG - Exonic
966378695 3:179322889-179322911 CGGCAGGGGGCGCGGGCCGCTGG + Intergenic
966878883 3:184338631-184338653 CGGATAGCGCCTCCGCCCGCCGG - Intronic
967087590 3:186108885-186108907 CGGAAGGGGCGTCCGGCCACTGG - Intronic
968489593 4:882903-882925 GTGCGGGGGCCTCCGCCAGCTGG + Intronic
968508996 4:987194-987216 CCGCAGGGGCCACAGCGCGCGGG - Exonic
968619430 4:1597203-1597225 CGGCAGGGCCCTCAGCCGCCTGG + Intergenic
968809357 4:2793059-2793081 CGCCAGGCGCTCCCGCCCGCGGG - Intronic
968917969 4:3505496-3505518 TGGCAGGGGCCTCCTGCGGCCGG + Intergenic
971279962 4:25234464-25234486 CGACAGGGGCAGCCGCCCGGAGG - Intronic
971352223 4:25864012-25864034 GGGGAGGGGCCTCCGGCCGGCGG + Intronic
985619398 5:946082-946104 CGGCCGGGGCATCTGCCGGCAGG - Intergenic
985660909 5:1156056-1156078 CGGCAGCGGTCCCTGCCCGCGGG + Intergenic
988796277 5:34656245-34656267 CGGCGGGGGCCGGCGCCCGGCGG + Intronic
993168186 5:84383840-84383862 CTGCAGGGCCGTCCGCCCCCGGG - Intronic
993915751 5:93741480-93741502 CCGCAGGGGCATCGGCCCTCTGG + Exonic
998128141 5:139637850-139637872 CTGCTGGCGCCTCCGCCCGCCGG - Intergenic
998378503 5:141707602-141707624 CGGCAGTGGCCTTGGCCGGCTGG + Intergenic
998467495 5:142357271-142357293 GGGCCGGGGGCTCCTCCCGCAGG - Intergenic
999223423 5:150000507-150000529 CGGCCGGGGCGTCCCACCGCCGG + Exonic
1001035288 5:168292452-168292474 CGGCAGGCGCCTCCTCTCGGTGG - Intronic
1002656110 5:180748830-180748852 AGGCAGGAGCCTCCTCCCCCAGG + Intergenic
1002788899 6:424345-424367 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002788917 6:424383-424405 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002788935 6:424421-424443 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002788953 6:424459-424481 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002788989 6:424535-424557 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002789007 6:424573-424595 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002789025 6:424611-424633 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002789061 6:424687-424709 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002789079 6:424725-424747 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1002789097 6:424763-424785 CGGCGGGGGGCTCCGTCGGCGGG - Intergenic
1005582973 6:27251160-27251182 TGTCAAGGGACTCCGCCCGCTGG - Intronic
1006327712 6:33366260-33366282 TGGCAGGGGCCTCCACTCCCTGG + Intergenic
1007327481 6:41073277-41073299 CTGCAGGGGCCGCCCCGCGCGGG + Intronic
1007506837 6:42342107-42342129 TGGCATGGGCCTCTGCCCTCAGG - Intronic
1010980651 6:82365281-82365303 CTGCCGGCGCCTTCGCCCGCCGG + Exonic
1012912912 6:105137248-105137270 CGGCGCCGGGCTCCGCCCGCCGG - Intergenic
1013556212 6:111259595-111259617 CCGCCGGGGCCTCCGCCTGCAGG - Exonic
1015103399 6:129507524-129507546 CGGCAGGGGCCTCTGCCATGTGG - Exonic
1015554960 6:134451734-134451756 AGGCAGGGGCCTGGGCCTGCAGG - Intergenic
1017106789 6:150895335-150895357 CGGCAGGGCCCTGCTCCCTCGGG + Intronic
1017672220 6:156778644-156778666 CCGCCGGGGCCGCCGCTCGCAGG - Exonic
1017696572 6:157021650-157021672 CGGCCGGCGCCTCCTTCCGCGGG - Intronic
1018830050 6:167435218-167435240 CGGCAGGGTCCTCCGCTCTGGGG - Intergenic
1019299236 7:295279-295301 CGGCAGGGTCCTCTGCCCACTGG + Intergenic
1019431448 7:1001594-1001616 CGGCAGGACCCCCCACCCGCAGG - Intronic
1019442609 7:1055084-1055106 AGGCCGTGGCCTCTGCCCGCAGG - Intronic
1022363377 7:29685058-29685080 CGGCGGCGGCCTCCGGCCCCCGG + Intergenic
1023999990 7:45183715-45183737 GGGCCGGAGCCTCTGCCCGCAGG + Exonic
1024472263 7:49775786-49775808 CGGCCAGGGCTTCCGCCTGCGGG - Exonic
1024963863 7:55004848-55004870 GGGCAGGTGCCTCAGCCCTCGGG - Intergenic
1026522759 7:71131554-71131576 CGGCCGCCGCCGCCGCCCGCAGG - Intergenic
1028762258 7:94509686-94509708 CCGCAGCCGCCGCCGCCCGCCGG + Intronic
1029221582 7:98994784-98994806 GTGCAGTGGCCTGCGCCCGCCGG - Exonic
1029524839 7:101088223-101088245 CCGCAGCCGCCTTCGCCCGCCGG + Exonic
1030176510 7:106660450-106660472 CGGCCGGGGCTTCCTCCTGCGGG + Exonic
1034278978 7:149838586-149838608 CGGCACGGGCCTCCGAAAGCGGG + Exonic
1034617904 7:152435479-152435501 CGGGAGCCGCCACCGCCCGCGGG + Intronic
1034802892 7:154063676-154063698 CGGGAGGTGCCTCCCCCCGCTGG - Intronic
1035253782 7:157613583-157613605 CGGCTTGGGCCTCTTCCCGCGGG + Intronic
1035387290 7:158482456-158482478 CGGCAAGACCCTCCACCCGCAGG + Intronic
1037835585 8:22213125-22213147 CCGCAGGGGCCCCCACCCCCAGG + Intergenic
1038176316 8:25184630-25184652 CGGCCGCACCCTCCGCCCGCCGG - Intergenic
1043591920 8:81842615-81842637 CGGCATGGGCGCCCGCCCACCGG + Intronic
1044560652 8:93608787-93608809 AGGCAGGGGCATCCACCCCCAGG - Intergenic
1044819358 8:96145299-96145321 CCGCAGGGGGCGCCGCCGGCCGG - Exonic
1048072835 8:131040101-131040123 TGGTTGGGGCCGCCGCCCGCAGG + Exonic
1049347477 8:142146566-142146588 CGGGAGACGCCTCCGCCCTCGGG + Intergenic
1049349047 8:142154357-142154379 AGGCAGGTCCCTCCGGCCGCAGG + Intergenic
1049508982 8:143018439-143018461 CGGGAGGGGCCTCCGGCGGGCGG - Intronic
1049585394 8:143430489-143430511 CCGCCGGGACCGCCGCCCGCGGG - Intergenic
1049747618 8:144269716-144269738 CTGCAGAAGCCTCCGCCCGCCGG + Intronic
1056665488 9:88577944-88577966 CGGCAGGGGCCTGCGCCTAGGGG - Intronic
1058467811 9:105245558-105245580 CCGCAGGGGCCTCCGAGTGCGGG - Intronic
1061268485 9:129522587-129522609 GGCCAGGGGCCTCCTCCCACAGG + Intergenic
1061365840 9:130172226-130172248 TGGCCGCGGCCTCCGCCAGCTGG - Intergenic
1061959814 9:133982254-133982276 CGGCAGGGGCGACGGCCGGCCGG + Intronic
1062507588 9:136886110-136886132 CGGCAGGGGTCTCCGCCCCGGGG + Intronic
1062517680 9:136944435-136944457 AGGCAGTGGCCTCCGCCCTGCGG + Intronic
1062620271 9:137417411-137417433 CAGCAGGGGCCTCCGCGCCGCGG - Intronic
1203773690 EBV:61562-61584 CGGCCTCGGCCTCCGCCCGCAGG + Intergenic
1185889875 X:3814553-3814575 AGGCAGGGGCTGCCGCTCGCGGG + Intergenic
1188811465 X:34657462-34657484 TGGCACTGGGCTCCGCCCGCGGG - Intergenic
1189325456 X:40108571-40108593 CTCCAGAAGCCTCCGCCCGCCGG + Intronic
1190265895 X:48827018-48827040 GGCCCGGGGCCTCAGCCCGCGGG - Intergenic
1195954718 X:110317496-110317518 GGGCAGGGGCATCCGCCGGCCGG + Intronic