ID: 1163262997

View in Genome Browser
Species Human (GRCh38)
Location 19:16202483-16202505
Sequence GGGGTGTGAAGAAGCTTTCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 141}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163262997_1163263003 2 Left 1163262997 19:16202483-16202505 CCCCGAAAGCTTCTTCACACCCC 0: 1
1: 0
2: 1
3: 12
4: 141
Right 1163263003 19:16202508-16202530 TGCTGTCTAGCCCCATCCCTAGG 0: 1
1: 0
2: 1
3: 19
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163262997 Original CRISPR GGGGTGTGAAGAAGCTTTCG GGG (reversed) Intronic
902166640 1:14577482-14577504 GAGGTGAGAAGTAGCTTTGGAGG + Intergenic
907317148 1:53579735-53579757 GGGGTGTGATGATGTTTTCCTGG - Intronic
907387442 1:54135186-54135208 GGGGTGGGGGGAAGCTTTAGGGG + Intronic
907447610 1:54519063-54519085 GGGGTGAGAAGGAGCTTTCCAGG + Intergenic
907531096 1:55098059-55098081 TGAGCGTGAAGAAGCTTTCATGG - Exonic
909864963 1:80656174-80656196 GTGGTTTGAAGAAGCTTACCAGG + Intergenic
915359800 1:155278960-155278982 AGGCTGTGAAGATGCTTTCATGG + Intronic
915368169 1:155326847-155326869 GGGGTCTGAAGCAGCTTCCTTGG - Exonic
916827601 1:168457591-168457613 GGGGTGTGAGCAAGCCTCCGAGG + Intergenic
917708188 1:177656240-177656262 GGAGAGTGGAGAAGCTTTAGAGG + Intergenic
918625714 1:186653901-186653923 AGGGTGTGAAAAAGCCTTCTTGG + Intergenic
919485982 1:198147555-198147577 TGGCTGGGAAGAAGCTTTCTAGG + Intergenic
1063276927 10:4579569-4579591 ACGGTGTGAAGAAACTTTTGGGG + Intergenic
1064077450 10:12280583-12280605 TGGGTATGAAGAAACTTTCTGGG - Intergenic
1065600444 10:27362627-27362649 GAGGAGAGAAGAGGCTTTCGTGG + Intergenic
1068037332 10:51777352-51777374 GGAATGAGAAGAAGCTTTCTCGG - Intronic
1071246830 10:83774000-83774022 GGGGTCTGAAGAAAGTTTCTGGG - Intergenic
1072729509 10:97836174-97836196 GGGGAGAGGAGAAGCATTCGTGG - Intergenic
1076083784 10:127607001-127607023 GGGGCCTGAAGGAGCTTTCTGGG - Intergenic
1084327057 11:68406561-68406583 GGGGTGTGAAGAAGCACAGGTGG - Exonic
1086449095 11:86898724-86898746 GGGGTGAGCAGAGGCTTTCCAGG + Intronic
1088917013 11:114235123-114235145 GTGGGGAGAAGAAGCTTTCGGGG + Intronic
1089590471 11:119537169-119537191 GGGGAATGAAGATGCTTTCAAGG - Intergenic
1089635895 11:119811617-119811639 GGGGCATGAAGAAACTTTTGGGG - Intergenic
1089842243 11:121428347-121428369 GGGGTGTGGAGAGGCTTGCCAGG + Intergenic
1091793415 12:3284158-3284180 GGGGTGTGCAGAACCTGTTGTGG - Exonic
1092286297 12:7130773-7130795 GGGGTGGGAAGGAGGTGTCGAGG + Intronic
1096074799 12:48796339-48796361 GGGGTGTGAAGAAGCAAGAGCGG + Intergenic
1096405921 12:51344210-51344232 GGGGTGTGTAGATGCTTCTGGGG + Intronic
1101854580 12:108431634-108431656 GGGGTGGGTAGAAGCTTTTTTGG - Intergenic
1102893441 12:116579835-116579857 TGAGTGTGAAGAAGCCTTCTAGG + Intergenic
1105284165 13:18991338-18991360 GGGGTGTGGAGACGCATTCATGG - Intergenic
1105518916 13:21114184-21114206 CTGGTGTGATGAAGCCTTCGAGG + Intergenic
1105632033 13:22179098-22179120 GAGGTGTGAGGAAACTTTTGAGG - Intergenic
1105779882 13:23696472-23696494 GGGGTGTGAGGGAGCTCCCGTGG - Intergenic
1108789766 13:53954294-53954316 TTGATGTGTAGAAGCTTTCGTGG - Intergenic
1111925190 13:94456316-94456338 TGGGTGTGAAGTAGCTTTCTGGG - Intronic
1119068154 14:71551692-71551714 GGGCTGTGAGGAAGCTTGCAGGG - Intronic
1119692429 14:76686472-76686494 GGGGTATGAGGAAGCTTTGGAGG - Intergenic
1121577700 14:95001773-95001795 GGGGTGAGAACAAGCTTCTGGGG + Intergenic
1122419247 14:101564851-101564873 GGGATGAGAAGGAGCGTTCGCGG - Intergenic
1123804693 15:23859232-23859254 GAGGTGTGAAGAAGCAATCTAGG + Intergenic
1123913789 15:24999615-24999637 GGGGTCTGAAGAAACTCTCCAGG - Intergenic
1123971105 15:25508635-25508657 GGGGTGGGGGGAAGCTTTGGGGG - Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1131079515 15:89523083-89523105 AGGCTGTGAAGAGGCTTTCCTGG - Intergenic
1133184665 16:4086959-4086981 GGAGAATGAAGAAGCTTTGGAGG - Intronic
1134602822 16:15546842-15546864 GGGGTGTGAAGAAACTCCCCAGG - Intronic
1134913441 16:18049899-18049921 TGGGTCTGGAGAAGCTTTCACGG - Intergenic
1135866242 16:26105047-26105069 GTGGGGAGAAGAGGCTTTCGGGG - Intronic
1135881181 16:26259199-26259221 GGGGTGTGAAGAAGCAATGTAGG + Intergenic
1136054715 16:27680000-27680022 GGAGTGTGAAGAAGGCTTTGTGG - Intronic
1139648401 16:68348577-68348599 AGGGTGTGGTGAAGCTTTCATGG + Intronic
1141661047 16:85441702-85441724 GGGGTGTGTAGGAGTTTTCCAGG + Intergenic
1142687457 17:1585938-1585960 GGAGTGTGAAGACGCCTCCGAGG - Exonic
1145397119 17:22505083-22505105 GGGGTGTGGCCAAGCTGTCGTGG - Intergenic
1149477178 17:56972726-56972748 TGAGTCTGAAGAAGCTTTCCAGG + Intergenic
1156183941 18:34639539-34639561 GGGGTGTGAAGAAGGCTTGGAGG - Intronic
1156604002 18:38644012-38644034 GGGGTGTGAACATGTTTTAGTGG + Intergenic
1157323612 18:46653320-46653342 GGGGTGTGAAGGAGCATTCTGGG + Intronic
1157399104 18:47372049-47372071 GGTGAGTGAGGAAGCATTCGGGG - Intergenic
1158261722 18:55613210-55613232 GGGGCATGAGGAAGCTTTTGGGG - Intronic
1159057582 18:63481538-63481560 GAAGTGTTAAGAAGCTTTCAGGG + Intronic
1163262997 19:16202483-16202505 GGGGTGTGAAGAAGCTTTCGGGG - Intronic
1166220851 19:41363628-41363650 GGGGTGTGACGAAGCTAGCTTGG - Intronic
930021276 2:47003627-47003649 GGGGTGGGAAGAAGCTTGGCTGG - Intronic
931796740 2:65718138-65718160 GGGGTGTGAAGAAGCAGCCAGGG - Intergenic
932746197 2:74335514-74335536 AGGGTGAGAAGTAGCTTTCCAGG - Intronic
942167624 2:173257299-173257321 GGGGTATGAGGAAACTTTCTGGG - Intronic
942568005 2:177285576-177285598 GGGGTGGGATGAAGGTTTGGTGG - Intronic
943366411 2:186971366-186971388 GGGGTGTGGAGAAGCTTTTGTGG + Intergenic
943738831 2:191388856-191388878 GGGGAATGAAGAAGCTTTCTGGG - Intronic
944883105 2:204035309-204035331 GGAGTATGAAGAAACTTTCTGGG - Intergenic
1170951033 20:20936489-20936511 GGGGCGTGGAGAAGGTTTGGTGG - Intergenic
1173318523 20:41966771-41966793 GGGATGTGAAGGACCTTTCAGGG - Intergenic
1173915892 20:46708847-46708869 GGGGTGGGAAGGAGCTTATGGGG - Intergenic
1174534253 20:51238463-51238485 GGGGTCTGAAGAAACTTCCCAGG - Intergenic
1177571040 21:22887608-22887630 AGGGTTTGATGAAGCTTTTGGGG + Intergenic
1178051525 21:28752968-28752990 GGGGTAAGAAGAACCATTCGTGG - Intergenic
1179062380 21:37990821-37990843 GGTATGTGAAGAATCTTTGGTGG - Intronic
949259409 3:2087760-2087782 AGGGTATGAAGAAGCTTTCAGGG + Intergenic
951119215 3:18904755-18904777 GAGGTGTGAAGAAACTATTGGGG + Intergenic
952576842 3:34784510-34784532 GGGGTGTGAGGAAGGCTTCTGGG - Intergenic
953769032 3:45764794-45764816 GGGGTGTGAAGGAACTGTCTAGG + Intronic
954070619 3:48140274-48140296 GGAGTCGGAAGAAGCTTTGGAGG + Intergenic
954835702 3:53465789-53465811 GGAATGTGAAGAAACTTTCTGGG - Intergenic
955936037 3:64103524-64103546 GGGGTATGAAGAAGGCTTCTAGG + Intronic
956327038 3:68064673-68064695 GAGGAGTTAAGAAGCTTTCTTGG - Intronic
960417094 3:117398089-117398111 GGGGGTGGAAGAAGCTTTCTTGG + Intergenic
961179226 3:124863242-124863264 CAGGTCTGAAGAAGCTTTTGAGG + Intronic
964900592 3:161654253-161654275 GGGATGTGAAGGACCTTTCAAGG - Intergenic
965912316 3:173794076-173794098 AGGGTGGAAAGAAGATTTCGGGG - Intronic
967862830 3:194165532-194165554 GGGATGTGAGGAAACTTTTGAGG + Intergenic
969126086 4:4949295-4949317 GGGCTGTGATGAAGATTTCAGGG - Intergenic
969361584 4:6667484-6667506 GGGTTAGGAAGAAGCTTTTGGGG + Intergenic
969376099 4:6764201-6764223 GGGGTGTGAGGGAGCATTCTGGG + Intergenic
969394904 4:6914211-6914233 GGGTTGTGAAGGAGCCTTTGAGG + Intronic
969871311 4:10106864-10106886 GGGGTGTGAGGTATCTTTCTGGG - Intronic
972425249 4:38926874-38926896 GGGGTGTGAAGCAGGGTTCCTGG - Intronic
972891656 4:43564285-43564307 AGGGTGTGAAGAAGCAGTTGTGG + Intergenic
973097400 4:46219715-46219737 AGGGTGGGAAGAAACTTTGGAGG - Intergenic
973548857 4:52011076-52011098 GGGGGATGAAGAAGCTTTTGCGG + Intronic
977021723 4:91768683-91768705 GGGATAAGAAGAAGCTTTAGAGG + Intergenic
977966290 4:103152832-103152854 GAGGTGTGAGGAAACTTTCTGGG + Intronic
979165089 4:117518805-117518827 GGGATGTGAAGGACCTTTCAAGG - Intergenic
979895533 4:126151417-126151439 AGGGTGTGAGAAAGCTTTCCGGG - Intergenic
988305096 5:29484254-29484276 GGGCTGAAAAGAAGCTTTCTAGG + Intergenic
993651077 5:90522838-90522860 GTGATGTGAAGAAGATTTCAAGG - Intronic
993817759 5:92573496-92573518 GTGTTGTTAAGAAGCTTTCGCGG + Intergenic
994821268 5:104653358-104653380 GGGCTGTGATGAAGCTTTTCTGG - Intergenic
996464847 5:123788056-123788078 GATGTGTGAAGAATCTTTCTAGG + Intergenic
997133946 5:131304982-131305004 GGGCTGAGAAGAAACTTTTGGGG - Intronic
997973164 5:138420891-138420913 GGGGTTTGAGGAAGTTTTCCCGG - Exonic
1000407077 5:160899422-160899444 GGGGTATGAGGAAACTTTGGGGG + Intergenic
1000682453 5:164202606-164202628 GGGTTGAGTAGAAGCTTTCCAGG - Intergenic
1002475404 5:179462244-179462266 GGGGTGTGAGGAAGCACACGTGG - Intergenic
1003348258 6:5291414-5291436 GGTGGGTGAAGAGGCTTTAGAGG + Intronic
1007938477 6:45754823-45754845 AGGGTCTGAAGAGGCTTTCTTGG + Intergenic
1008738749 6:54579262-54579284 GGGGTCTGAAGAAACTTCCCAGG + Intergenic
1010042715 6:71405647-71405669 GGGGTTAGAAGAAGCTGTCCTGG - Intergenic
1010697916 6:79000871-79000893 AGGGTGAGAAGAAGCATTAGAGG - Intronic
1011625979 6:89284187-89284209 GGGGTGTGAGGGAGCCTTCTGGG + Intronic
1013417949 6:109941160-109941182 TGGCTGTGAAGAAGATTTCCAGG - Intergenic
1015774941 6:136804521-136804543 GGGGCATGAAGAAACTTTTGAGG + Intergenic
1016590783 6:145741239-145741261 GGGATGTGAAGGACCTTTCAAGG - Intergenic
1018007742 6:159638998-159639020 GGGGCATGAAGAAACTTTCAGGG + Intergenic
1018093436 6:160364378-160364400 GAGGTGTGAAGCAGCCTTCATGG + Intronic
1018633790 6:165843226-165843248 GGGGTGTGAAGATGCCTTATAGG + Intronic
1018845013 6:167549686-167549708 GGGATGTGAAGAAGGTTAGGAGG - Intergenic
1022420863 7:30222273-30222295 GGGGAATGAAGAAGCTTTTGGGG + Intergenic
1023513456 7:40977590-40977612 GGGGTATGAACAAGCTTACAAGG + Intergenic
1025183744 7:56840107-56840129 GGGATGTGAAGGACCTTTCAAGG - Intergenic
1030627017 7:111855331-111855353 GGGGTGTGGAGAAGCTACAGAGG + Intronic
1033442626 7:141394225-141394247 CGGGGGTGAAGAAGCTGTCACGG - Intronic
1037273069 8:17151345-17151367 TGGGGGTGAAGAAGCTTACTTGG - Intergenic
1038286463 8:26210130-26210152 GGGGTCTGAAGAAACTCTCCAGG + Intergenic
1040384316 8:46903415-46903437 GAGCTGTGAAGACGCTTTCTGGG - Intergenic
1041738155 8:61132919-61132941 GGTGTGGGAGGAAGCTTTTGTGG + Intronic
1045440283 8:102202180-102202202 GAGGTGTGAAGAAGCAATTGTGG - Intergenic
1045618628 8:103948691-103948713 TGGGTGTGAACAATCTTTTGGGG + Intronic
1046712125 8:117521565-117521587 GGGGTATGAAGAAACTTTCTGGG - Intronic
1048100763 8:131348769-131348791 GGTGTTTGAAGAAGCTTATGAGG - Intergenic
1051719800 9:20024760-20024782 GGGGTGGGGAGAACCTTTCAAGG + Intergenic
1059486339 9:114629905-114629927 GGGGTCTGTTGAAGCTTTCATGG + Intronic
1062016963 9:134295858-134295880 CGGGTGTGAAGAAGCCCTGGAGG - Intergenic
1062280176 9:135748340-135748362 GGTGTGTGCAGCAGCCTTCGTGG - Intronic
1185627630 X:1493623-1493645 CAGGTGTGAAGAAGATTTCTGGG + Intronic
1185891117 X:3822786-3822808 GGAGTGTGAACAAGCGTGCGAGG + Intronic
1185896220 X:3861200-3861222 GGAGTGTGAACAAGCGTGCGAGG + Intergenic
1185901339 X:3899626-3899648 GGAGTGTGAACAAGCGTGCGAGG + Intergenic
1186432051 X:9513362-9513384 GGGGGGTGCAGAAGATTTGGAGG + Intronic
1186434113 X:9528671-9528693 GGGGAGTGCAGGAGCTTGCGGGG + Intronic
1187935423 X:24331263-24331285 GTGGTTTGAACAAGCTTTCCAGG - Intergenic
1188260271 X:28015779-28015801 GGTGTGAGAAGAAGCTTACAGGG - Intergenic
1189155840 X:38756100-38756122 GGTGCTTGAAGAAGCTTTGGGGG - Intergenic