ID: 1163266503

View in Genome Browser
Species Human (GRCh38)
Location 19:16225548-16225570
Sequence GCAGGACCGTCGCCCCGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163266495_1163266503 13 Left 1163266495 19:16225512-16225534 CCAGCATCTTGGCTCACGCAGGA 0: 1
1: 0
2: 0
3: 4
4: 116
Right 1163266503 19:16225548-16225570 GCAGGACCGTCGCCCCGGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163266503 Original CRISPR GCAGGACCGTCGCCCCGGTG TGG Intronic
900164116 1:1237864-1237886 CCGTGACCGTCGCCCCGGCGGGG - Intergenic
900932013 1:5743630-5743652 GCAAGCCCGTCCCCCAGGTGTGG + Intergenic
915942658 1:160128782-160128804 GCATGACCGTCGCCCACATGTGG + Exonic
915947777 1:160166658-160166680 GCATGACCGTCGCCCACATGTGG + Exonic
918344080 1:183591056-183591078 GCAGGAAAGTCCCCCCAGTGCGG - Intronic
1063537695 10:6901056-6901078 GCAGGAAAGTCCCCCCAGTGTGG + Intergenic
1075730408 10:124632163-124632185 GCAGAAACGTCGCCACCGTGTGG - Intronic
1076373600 10:129969412-129969434 TCAGGTCCGTCGCCCCGCTGCGG - Intergenic
1076408942 10:130232292-130232314 GCAGGAACGTCTCCCCCGAGCGG + Intergenic
1083806861 11:65079536-65079558 GCAGGACCGGCGGCCTGGGGTGG + Exonic
1083920065 11:65777812-65777834 GCAGGACTGTGGCCCTTGTGGGG - Exonic
1104330393 12:127839081-127839103 GCATGTCCTTCGCCCCTGTGGGG - Intergenic
1104989733 12:132618840-132618862 GCCGGGCGGTCGCCCCGGCGGGG - Exonic
1113805852 13:113109769-113109791 GCAGCACGGCCGCCCCGGGGCGG + Intronic
1113869479 13:113549510-113549532 GCTGGACCGTCTCTCCGGTCTGG - Exonic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1117867518 14:60165171-60165193 GCAGGGACGACGCCCAGGTGAGG - Exonic
1132247359 15:100307846-100307868 GCAAGACTGTCGTCCAGGTGTGG - Intronic
1132846834 16:2004599-2004621 GCATGACCCTTGCCCGGGTGAGG - Intronic
1133113752 16:3564559-3564581 CCAGGACCGTCGCCCTGGACCGG - Exonic
1133792815 16:9022290-9022312 CCAGGACCGTAGCTCAGGTGTGG + Intergenic
1136861514 16:33707099-33707121 GCAGGCCCGTCACCCAGGTCAGG - Intergenic
1144641464 17:16939624-16939646 GCAGGACTGTGGTCCTGGTGTGG + Exonic
1145266386 17:21381475-21381497 GCAGGAGCGTGGCCCCGGGGAGG - Intronic
1150212090 17:63446898-63446920 GCAGTATCGTCTCCCCCGTGGGG - Intergenic
1160508885 18:79442313-79442335 GCAGGACCGACGCCTCGGCGAGG - Intronic
1163124498 19:15237715-15237737 GCAGGACAGTCGCCTCGCTCCGG + Exonic
1163266503 19:16225548-16225570 GCAGGACCGTCGCCCCGGTGTGG + Intronic
1163516415 19:17766665-17766687 CCAGGACCTTCGCCCCGCTCTGG + Exonic
1163747024 19:19054747-19054769 GCAGGACCGTGGCACCCCTGGGG - Intronic
1165786216 19:38463511-38463533 GCTGGACCTACGGCCCGGTGAGG + Exonic
1167558525 19:50210710-50210732 GCAGGACCGAGGCCTCGTTGAGG - Exonic
932625692 2:73293829-73293851 ACCGGACGGTCGGCCCGGTGAGG - Intergenic
936516210 2:113183038-113183060 GCAGGCCCGTGTCCCCGGGGAGG - Exonic
937043075 2:118835960-118835982 GCAGGACCTGCGCCCCGCGGTGG + Intergenic
1178270192 21:31182465-31182487 GCAGGGCCGTCCACTCGGTGGGG + Exonic
954799376 3:53178416-53178438 GCAGGAACGGCGCCATGGTGGGG - Exonic
966496835 3:180590589-180590611 GCAGGGCCGGGGCACCGGTGAGG - Intergenic
966743527 3:183254479-183254501 GCCGGGCCGCCGCCCAGGTGCGG + Intronic
968904766 4:3446099-3446121 GCAGGCCTGGCGCCCCGGGGAGG - Exonic
982488604 4:155999897-155999919 GCTGAACCCGCGCCCCGGTGTGG - Intergenic
985705543 5:1399616-1399638 GCAGGACCGGAGGCCCAGTGGGG + Intronic
1035345076 7:158192326-158192348 GCAGGACAGACCCCCCGCTGAGG - Exonic
1036645456 8:10609294-10609316 GCAGGAGCAGCTCCCCGGTGAGG + Exonic
1045443619 8:102239009-102239031 GCAGGACCGGCGCGGCGGGGCGG - Exonic
1045701891 8:104876275-104876297 GCAGTACCATCACCCCAGTGAGG + Intronic
1054301647 9:63384996-63385018 GCAGGCCCGGCACCCCGGTCAGG - Intergenic
1200914483 Y:8559425-8559447 GCAGGACCGTCTCACTGGAGGGG + Intergenic