ID: 1163267898

View in Genome Browser
Species Human (GRCh38)
Location 19:16232712-16232734
Sequence CTAGGCGGCAGTAGCTCCCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 74}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163267887_1163267898 21 Left 1163267887 19:16232668-16232690 CCCAGGTGCACGGGGACCGCCCC 0: 1
1: 0
2: 0
3: 3
4: 99
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267886_1163267898 22 Left 1163267886 19:16232667-16232689 CCCCAGGTGCACGGGGACCGCCC 0: 1
1: 0
2: 0
3: 4
4: 95
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267890_1163267898 5 Left 1163267890 19:16232684-16232706 CCGCCCCTGCTGTGAGGCAGAAA 0: 1
1: 0
2: 5
3: 24
4: 260
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267884_1163267898 27 Left 1163267884 19:16232662-16232684 CCCTGCCCCAGGTGCACGGGGAC 0: 1
1: 0
2: 1
3: 14
4: 194
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267893_1163267898 0 Left 1163267893 19:16232689-16232711 CCTGCTGTGAGGCAGAAACAGCC 0: 1
1: 0
2: 0
3: 34
4: 260
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267888_1163267898 20 Left 1163267888 19:16232669-16232691 CCAGGTGCACGGGGACCGCCCCT 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267891_1163267898 2 Left 1163267891 19:16232687-16232709 CCCCTGCTGTGAGGCAGAAACAG 0: 1
1: 0
2: 2
3: 39
4: 317
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267892_1163267898 1 Left 1163267892 19:16232688-16232710 CCCTGCTGTGAGGCAGAAACAGC 0: 1
1: 0
2: 1
3: 23
4: 265
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74
1163267885_1163267898 26 Left 1163267885 19:16232663-16232685 CCTGCCCCAGGTGCACGGGGACC 0: 1
1: 0
2: 1
3: 20
4: 232
Right 1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163267898 Original CRISPR CTAGGCGGCAGTAGCTCCCA CGG Intronic
900220284 1:1505067-1505089 CTAGGTGGCAGTGGTTCCCCGGG - Intergenic
901078686 1:6571452-6571474 CTGAGTGGCAGTAGTTCCCAAGG - Intronic
902112606 1:14095192-14095214 CTAGGGGGCAGTATTTCCCTTGG + Intergenic
903409698 1:23131291-23131313 TTAGGAGGCAGTAGCTGCCATGG - Intronic
903673961 1:25052947-25052969 CCAGGTGGCAGCTGCTCCCATGG + Intergenic
910835363 1:91503049-91503071 CTTGGCGGCAGTATCTCCTCTGG + Intronic
923087599 1:230713270-230713292 CCAGGATGCAGTAGGTCCCAGGG - Intronic
924477118 1:244392139-244392161 CTAGGCGGCAATACCTTGCAGGG - Intergenic
1067519120 10:46981827-46981849 CTAGGTGGCAGTACCTTGCAGGG + Intronic
1067643125 10:48070007-48070029 CTAGGTGGCAGTACCTTGCAGGG - Intergenic
1068953753 10:62804287-62804309 CTAGGCAGCACTGTCTCCCACGG - Intergenic
1073338344 10:102727177-102727199 CCAGGCAGCTGTACCTCCCACGG - Intronic
1074385958 10:113016888-113016910 CCAGGCAGCAGAAGCTGCCAGGG - Intronic
1077158770 11:1103237-1103259 CGAGGCAGCTGCAGCTCCCATGG + Intergenic
1077220409 11:1413190-1413212 CTGGGAGGCAGAAGCCCCCAGGG - Intronic
1083235671 11:61349313-61349335 GAAGGTGGCAGTGGCTCCCAGGG + Exonic
1084696278 11:70757457-70757479 CCCTGCGGCAGCAGCTCCCATGG + Intronic
1091588104 12:1827544-1827566 CTACGCGGCTGCAGCTGCCAAGG + Exonic
1100811020 12:98338467-98338489 GGAGGAGGCAGTGGCTCCCATGG + Intergenic
1101815711 12:108144625-108144647 CTAGAAGGCAGGAGCTCCAAGGG - Intronic
1107656306 13:42595170-42595192 CTAGGTGGCAGTATCTCAGAAGG + Intronic
1119465245 14:74852557-74852579 CTAGGAGAGAGTAGCACCCAAGG + Intronic
1128386991 15:67156785-67156807 CTATGGGGCAGTAGCTGCCTGGG + Intronic
1128729181 15:70009225-70009247 CAAGGGGGCAGTAGCTTCAAGGG + Intergenic
1129709630 15:77813973-77813995 CTAGGGGGCAGGAGAGCCCAGGG - Intronic
1130358881 15:83161670-83161692 CTTGCCGGCAGTAGCTAACATGG - Intronic
1137514523 16:49131464-49131486 CTTTGCTGCAGTAGCCCCCAGGG + Intergenic
1138303257 16:55950181-55950203 CAAGGCAGCAGGAGCACCCAAGG + Intronic
1142760886 17:2041477-2041499 CTAGGCGGCCGTGGCTCTGAGGG + Exonic
1149995074 17:61402021-61402043 CAGGGCGGCAGGATCTCCCAGGG + Intronic
1151227481 17:72657871-72657893 CTAGAGGGCAGTAGATCCAAGGG - Intronic
1159353032 18:67299652-67299674 CTAGGCAGCAGCAGCACCCCAGG - Intergenic
1160493160 18:79354738-79354760 CGAGGCGGCAGGAGCTCCCCGGG + Intronic
1162290387 19:9775706-9775728 CAAGGCAGCAGTAGCTCACTTGG + Intronic
1163267898 19:16232712-16232734 CTAGGCGGCAGTAGCTCCCACGG + Intronic
1165738880 19:38194002-38194024 CTAGGAGTCAGAAGCACCCAAGG + Intronic
926126755 2:10276939-10276961 CTAGGCGCCAATAGCACCCCTGG - Intergenic
926157773 2:10467063-10467085 CTGGGCGGGTGTAGCTCTCAGGG + Intergenic
929825207 2:45304615-45304637 CTAGGAGGATGTAGCTCCAAAGG - Intergenic
932262902 2:70342023-70342045 CTAGGAGGCAGTGGCCCTCAGGG + Intergenic
933103060 2:78284379-78284401 CTAGGTGGCAGTACCTTGCAGGG + Intergenic
939091878 2:137789569-137789591 TTAGGAGGCATTTGCTCCCAGGG - Intergenic
1170825771 20:19793833-19793855 CAATGCGTCAGTAGCTACCATGG - Intergenic
1173553423 20:43948981-43949003 CTAGGGGGCTGCTGCTCCCATGG - Intronic
1175286771 20:57841766-57841788 CCAGGCGGCAGCAGCACCCCTGG + Intergenic
1179642278 21:42755654-42755676 CTGGCCTGCAGCAGCTCCCAGGG + Intronic
950850563 3:16058377-16058399 CTAGGAGGCAGGAGCTTCCCAGG - Intergenic
952611678 3:35217007-35217029 GTGGGCAGCAGAAGCTCCCAGGG - Intergenic
953278657 3:41530527-41530549 TTAGGCGGGGGTAGCTCCAATGG - Intronic
959595628 3:108125730-108125752 ATAGGCGGCAGTTCCTCCCTGGG - Intergenic
963844735 3:150143733-150143755 CTGGGCACCAGAAGCTCCCATGG - Intergenic
974786544 4:66625376-66625398 CTAGGTGGCAATGCCTCCCAGGG + Intergenic
982164817 4:152604889-152604911 CTAGGCAGCAGCTTCTCCCATGG - Intergenic
982940073 4:161539369-161539391 CTAGGAGCCAGTAGCTCTCAAGG + Intronic
985718768 5:1477707-1477729 GTAGGCAGCAGGTGCTCCCAGGG - Intronic
985897877 5:2759990-2760012 CTCTGCGGCAGCAGCTGCCAGGG + Intergenic
994760469 5:103845954-103845976 CTATGCGGCAGAAACTTCCAAGG + Intergenic
995794225 5:115924816-115924838 CCAGGGCGCAGTAGCACCCAAGG - Intergenic
1002458658 5:179361358-179361380 TGAGGGGGCAGCAGCTCCCACGG + Intergenic
1006358734 6:33575735-33575757 CAGGGAGGCAGTAGCTCGCATGG - Intronic
1007597476 6:43060315-43060337 CTGGGAGACAGTAGCTCCCTAGG + Intronic
1017783443 6:157734502-157734524 CTGGGAGGCAGCAGCACCCAAGG + Intronic
1024061555 7:45702583-45702605 CTAGGAGGCAGAAGCCACCAGGG - Intronic
1024464747 7:49700412-49700434 CTTGACTGCAGCAGCTCCCAGGG - Intergenic
1026732693 7:72925297-72925319 CCAGGCCGCGGTAGCCCCCACGG - Intronic
1026960751 7:74405761-74405783 CACGGAGGCAGAAGCTCCCAAGG - Exonic
1030199653 7:106889778-106889800 CTAGGCTAAAGTAGCTCCCTTGG - Intronic
1032085560 7:128881632-128881654 ATACGGGGCAGCAGCTCCCAGGG + Exonic
1034353546 7:150433035-150433057 CTTGGTGGCAGCATCTCCCAGGG + Intergenic
1036938644 8:13030476-13030498 CTCGGAGTCAGTGGCTCCCAAGG - Intronic
1041558117 8:59182734-59182756 CTAAGAGGCAGAAGCTGCCAGGG + Intergenic
1041897974 8:62948036-62948058 CTAAGCGGCAGTTGCTCATATGG - Intronic
1047458923 8:125043241-125043263 CTCGGCAGTAGGAGCTCCCAGGG - Intronic
1049580084 8:143407155-143407177 CTAGGCGGCAGGGACTCCCCAGG + Intergenic
1057394640 9:94669017-94669039 CTAGGTGCCAGTAGCATCCACGG + Intergenic
1060804942 9:126569387-126569409 CTAGGTGGCAATAGCTTGCAGGG - Intergenic
1190380661 X:49837102-49837124 CGAAGCGGCTGTGGCTCCCAAGG - Intergenic
1198235339 X:134731819-134731841 CAAGGAGGCAAAAGCTCCCAAGG - Intronic