ID: 1163275627

View in Genome Browser
Species Human (GRCh38)
Location 19:16282477-16282499
Sequence GGGTGGAACCCAGAATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1163275614_1163275627 30 Left 1163275614 19:16282424-16282446 CCCAAACAGGTTGGCACTTGGAC No data
Right 1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG No data
1163275623_1163275627 -9 Left 1163275623 19:16282463-16282485 CCAGACCGAGGGCCGGGTGGAAC No data
Right 1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG No data
1163275616_1163275627 8 Left 1163275616 19:16282446-16282468 CCAAAAGTGTGTGAGACCCAGAC No data
Right 1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG No data
1163275622_1163275627 -8 Left 1163275622 19:16282462-16282484 CCCAGACCGAGGGCCGGGTGGAA No data
Right 1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG No data
1163275615_1163275627 29 Left 1163275615 19:16282425-16282447 CCAAACAGGTTGGCACTTGGACC No data
Right 1163275627 19:16282477-16282499 GGGTGGAACCCAGAATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1163275627 Original CRISPR GGGTGGAACCCAGAATCACA GGG Intergenic
No off target data available for this crispr